National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00001 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG2048 
 Symbol dco 
 Full Name discs overgrown 
 Synonym ck1epsilon, CKIepsilon, l(3)dco, l(3)dco-1, 1396/02, dbt, l(3)rK215, Dco/CK1, CG2048, l(3)j3B9, DBT, Dco, ddbt, 0915/10, CK1delta/epsilon, DBT/CK1epsilon, 1447/01, dCKIepsilon, CK1epsilon, 1460/09, DCO/CKIe, 0538/13, Dbt, l(3)discs overgrown, l(3)S053813, dco-1, l(3)S144701, l(3)discs overgrown-1, DCO 
 FBgn FBgn0002413 
 Gene Loc. 3R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 4 out of 4 
 Transcripts
CG2048-RD, CG2048-RC, CG2048-RB, CG2048-RA 
 Accession NM_001276203NM_079863NM_170536NM_170535
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01163.N2 
 21bp_seq_sense_
CTCGATTGTGGTGCTGTGCAA 
 21bp_seq_antisense
TTGCACAGCACCACAATCGAG 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.