National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00013 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG2210 
 Symbol awd 
 Full Name abnormal wing discs 
 Synonym e(shi)A, NDKB, Nm23/awd, eshiA, 1084/08, l(3)L8700, anon-WO0172774.80, Awd, BcDNA:RH27794, K-pn, Kpn, CG2210, NDPK, clone 2.27, anon-WO0172774.82, anon-EST:Liang-2.27, BcDNA:GM19775, anon-EST:Liang-2.28, clone 2.28, l(3)j2A4 
 FBgn FBgn0000150 
 Gene Loc. 3R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 3 out of 3 
 Transcripts
CG2210-RE, CG2210-RD, CG2210-RC 
 Accession
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01161.N2 
 21bp_seq_sense_
TACGAATAGACGGCTACTTTA 
 21bp_seq_antisense
TAAAGTAGCCGTCTATTCGTA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.