National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00051 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG4527 
 Symbol slik 
 Full Name Sterile20-like kinase 
 Synonym CG4527, Plkk/Slik, slk, Slik1, dPlkk/Slik, Slk, PLKK1, dPlkk, SLK, Slik, DPlkk1, Plkk1 
 FBgn FBgn0035001 
 Gene Loc. 2R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 6 out of 6 
 Transcripts
CG4527-RG, CG4527-RF, CG4527-RE, CG4527-RB, CG4527-RD, CG4527-RA 
 Accession NM_206214NM_001144280NM_001014549NM_166669NM_206213NM_138064
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01252.N2 
 21bp_seq_sense_
CTGGATGAAAGTGAGGTGTTA 
 21bp_seq_antisense
TAACACCTCACTTTCATCCAG 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.