National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00027 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG8049 
 Symbol Btk29A 
 Full Name Btk family kinase at 29A 
 Synonym CG8049, src28C, C-src4, dsrc29A, Tec, SRC 29A, C-src2, btk, src-4, src2, DSrc28, btk29a, Tec29A, Dm SRC2, fic, Src2, S13, Dsrc29A, btk29A, Tec29, CT41718, c-src/fps, btk29, src4, Src29A, DTec29, Dsrc28C, CG18355, tec29, CT2415 
 FBgn FBgn0003502 
 Gene Loc. 2L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 8 out of 8 
 Transcripts
CG8049-RH, CG8049-RG, CG8049-RE, CG8049-RF, CG8049-RA, CG8049-RD, CG8049-RB, CG8049-RC 
 Accession NM_001273315NM_001273314NM_001103651NM_001103650NM_057398NM_164804NM_057397NM_164805
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01198.N2 
 21bp_seq_sense_
AACGCGTTAACTGTTAGACAA 
 21bp_seq_antisense
TTGTCTAACAGTTAACGCGTT 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.