National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00036 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG11255 
 Symbol AdenoK 
 Full Name Adenosine Kinase 
 Synonym CG11255 
 FBgn FBgn0036337 
 Gene Loc. 3L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 3 out of 3 
 Transcripts
CG11255-RC, CG11255-RB, CG11255-RA 
 Accession NM_168532NM_140367
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01225.N2 
 21bp_seq_sense_
TAGAGCAATATTCGAATTTAA 
 21bp_seq_antisense
TTAAATTCGAATATTGCTCTA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.