National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00038 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG4379 
 Symbol Pka-C1 
 Full Name cAMP-dependent protein kinase 1 
 Synonym PKAcA, pka-C1, 6353, pKA, CG4379, dPKA, Pka-C, Dcpk, PKA-C1, l(2)cos[[1]], Dco, l(2)s4402, dcO, Cos1, PKA CI, pka-c1, Dc0, PkaC1, pka, C, pka C1, pkA, Cos-1, Pka, PKAC1, l(2)01272, dco, Cos, DC0, PKAc, PKA, PKA Cl, DCO, cos1, CdkA 
 FBgn FBgn0000273 
 Gene Loc. 2L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 3 out of 3 
 Transcripts
CG4379-RD, CG4379-RC, CG4379-RB 
 Accession NM_057629NM_205950NM_164866
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01234.N2 
 21bp_seq_sense_
CACGAGCAATTTCGATGACTA 
 21bp_seq_antisense
TAGTCATCGAAATTGCTCGTG 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.