National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00026 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference Dorogova NV, Khruscheva AS, Galimova IA, Oshchepkov DY, Maslov DE, Shvedkina ED, Akhmetova KA, Fedorova SA.
Migration of primordial germline cells is negatively regulated by surrounding somatic cells during early embryogenesis in Drosophila melanogaster.
Vavilovskii Zhurnal Genet Selektsii (2020) 24(5) 525-532 [ PubMed ID = 33659837 ] [ RRC reference ]  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG10033 
 Symbol for 
 Full Name foraging 
 Synonym dg2, Pkg24A, anon-WO0140519.260, For, Pkg2, BcDNA:GM08338, DG2, l(2)06860, anon-WO02059370.47, Dg2, FOR/PKG, 142251_at, PKG, CG10033 
 FBgn FBgn0000721 
 Gene Loc. 2L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 9 out of 9 
 Transcripts
CG10033-RK, CG10033-RA, CG10033-RI, CG10033-RG, CG10033-RD, CG10033-RH, CG10033-RJ, CG10033-RC, CG10033-RE 
 Accession NM_001169387NM_058139NM_205904NM_205907NM_134319NM_205906NM_001014464NM_058141NM_058142
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01194.N2 
 21bp_seq_sense_
TTCCTAGACGATGCTCTCTAA 
 21bp_seq_antisense
TTAGAGAGCATCGTCTAGGAA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.