National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00065 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG9326 
 Symbol vari 
 Full Name varicose 
 Synonym Vari, l(2)38EFa, l(2)03953b, CG9326, l(2)03953, 38E.21, szar 
 FBgn FBgn0250785 
 Gene Loc. 2L 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 5 out of 5 
 Transcripts
CG9326-RF, CG9326-RE, CG9326-RC, CG9326-RD, CG9326-RB 
 Accession NM_001273716NM_001273715NM_165343NM_206011NM_165342
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01437.N2 
 21bp_seq_sense_
CACGTTGGCGATGTCATCCTA 
 21bp_seq_antisense
TAGGATGACATCGCCAACGTG 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.