National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock request_help.gif
Stock Detail
 TRiP No GL00004 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG3051 
 Symbol AMPKalpha 
 Full Name AMP-activated protein kinase alpha subunit 
 Synonym dAMPKalpha, snf1A, dAMPK, AMPK, DmAMPK alpha, Gprk-4, dAMPKa, CG3051, AmpKalpha, ampkalpha, AK, SNF1A, ampk, FBgn0023169, snf1a, Gprk4, AMPKalpha, EG:132E8.2 
 FBgn FBgn0023169 
 Gene Loc.
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 3 out of 3 
 Transcripts
CG3051-RC, CG3051-RB, CG3051-RA 
 Accession NM_206604NM_166880NM_057965
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01201.N2 
 21bp_seq_sense_
TACGCTGTTTCGCAAGATCAA 
 21bp_seq_antisense
TTGATCTTGCGAAACAGCGTA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.