National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

TRiP Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 TRiP No GL00005 
 Genotype y1 sc v1; P{TRiP}attP2 
 Reference  
 Comment  
Gene Target: FB2014_04, released July 21st, 2014 
 CG No. CG6963 
 Symbol gish 
 Full Name gilgamesh 
 Synonym Gish, Hrr25, CKIgamma, CK1gamma, CK1-gamma, anon-WO0118547.425, CK1[[gamma]], ms(3)89B, Spider, CKI-related, CK1, CG6963, spider, NEST:bs27c08 
 FBgn FBgn0250823 
 Gene Loc. 3R 
 Gene Target Summary Target 1 gene, all isoform(s) 
 Gene target  Transcripts targeted 13 out of 13 
 Transcripts
CG6963-RM, CG6963-RK, CG6963-RJ, CG6963-RL, CG6963-RH, CG6963-RG, CG6963-RF, CG6963-RC, CG6963-RE, CG6963-RD, CG6963-RA, CG6963-RB, CG6963-RI 
 Accession NM_001275696NM_001260209NM_001260208NM_001275695NM_001014626NM_001014627NM_001014628NM_080202NM_176506NM_169713NM_169711NM_169712NM_001170157
Vector Information
 Vector VALIUM22 
 RNAi expressed germline 
 Hairpin Location attP2 
 Hairpin ID
SH01213.N2 
 21bp_seq_sense_
TCCGGAAGAGTTTGCGACATA 
 21bp_seq_antisense
TATGTCGCAAACTCTTCCGGA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.