National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Fragment Detail
Stock Detail- in silico PCR Fragment
 in silico PCR Fragment
GTGCAGCGGCCCATCATCTTCGACATCCGGTCCCAGCCCCGCAACGTTCCTGTGATAACG
GGCAGCAAGGATCTGCAGAATGTCAACATCACGCTCCGAATCCTGTACCGCCCCATTCCA
GACCAGCTGCCCAAGATCTACACCATT-CTCGGCCAGGACTACGACGAGCGTGTCCTGCC
CTCCATCGCGCCTGAGGTGCTGAAGGCTGTGGTCGCCCAGTTCGACGCCGGCGAGCTGAT
CACCCAGCGTGAGATGGTGTCGCAGCGCGTTTCCCAGGAACTGACTGTACGTGCCAAGCA
GTTCGGCTTTATTCTGGATGACATCTCGCTCACGCACTTGACCTTCGGTCGG-GAGTTCA
CGCTGGCCGTCGAGATGAAGCAGGTGGCCCAGCAGGAGGCGGAGAAGGCGC-GTTTTGTC
GTGGAGAAGGCCGAGCAACAGAAGCTGGCGTCCATCATTTCGGCGGAGGGTGATGCCGAA
GCCGCTGGCCTGTTGGCCAAGTCA
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.