National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID GFP-IR-1 
 Symbol Avic:GFPEGFP  Full Name Green Fluorescent Protein 
 CG No   Old CG No  
 Synonyms GFP, T:GFP 
 Accession No (Link to NCBI) NM_00GFP 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Morán T, Bernués J, Azorín F.
The Drosophila histone demethylase dKDM5/LID regulates hematopoietic development.
Dev. Biol. (2015) 405(2) 260-8 [ PubMed ID = 26183107 ] [ RRC reference ]

Defaye A, Evans I, Crozatier M, Wood W, Lemaitre B, Leulier F.
Genetic ablation of Drosophila phagocytes reveals their contribution to both development and resistance to bacterial infection.
J Innate Immun (2009) 1(4) 322-34 [ PubMed ID = 20375589 ] [ RRC reference ]

Leulier F, Ribeiro PS, Palmer E, Tenev T, Takahashi K, Robertson D, Zachariou A, Pichaud F, Ueda R, Meier P.
Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery.
Cell Death Differ. (2006) 13(10) 1663-74 [ PubMed ID = 16485033 ] [ RRC reference ]

Leulier F, Vidal S, Saigo K, Ueda R, Lemaitre B.
Inducible expression of double-stranded RNA reveals a role for dFADD in the regulation of the antibacterial response in Drosophila adults.
Curr. Biol. (2002) 12(12) 996-1000 [ PubMed ID = 12123572 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGTGAGCAAGGGCGAGGAG 
 Primer Seq. 3'
aatctagaggtaccCTTGAAGTTCACCTTGATGCC 
 Predicted Fragment Size
501 
 IR fragment full Seq
0001 ATGGTNANCA AGGGCGAGGA GCTGTTCACC GGGGTGGTGC CCATCCTGGT CGAGCTGGAC 
0061 GGCGACGTAA ACGGCCACAA GTTCAGCGTG TCCGGCGAGG GCGAGGGCNG ATGCCACCTA 
0121 CGGCAAGCTG ACCCTGAAGT TCATCTGCAC CACCGGCAAG CTGCCCGTGC CCTGGCCCAC 
0181 CCTCGTGACC ACCCTGACCT ACGGCGTGCA GTGCTNTCAG CCGCTACCCC GACCACATGA 
0241 AGCAGCACGA CTTCTTCAAG TCCGCCATAC CCGAAGGCTA CGTCCAGGAG CGCACCATCT 
0301 TCTTCAAGGA CGACGGCAAC TACAAGACCC GCGCCGAGGT GAAGTTCGAG GGCGACACCC 
0361 TGGTGAACCG CATCGAGCTG AAGGGCATCG ACTTCAAGGA GGACGGCAAC ATCCTGGGGC 
0421 ACAAGCTGGA GTACAACTAC AACAGCCACA ACGTCTATAT CATGGCCGAC AAGCAGAAGA 
0481 ACGGCATCAA GGTGAACTTC AAG 
 in silico PCR Fragment
0001 ATGGTGAGCA AGGGCGAGGA GCTGTTCACC GGGGTGGTGC CCATCCTGGT CGAGCTGGAC 
0061 GGCGACGTAA ACGGCCACAA GTTCAGCGTG TCCGGCGAGG GCGAGGGC-G ATGCCACCTA 
0121 CGGCAAGCTG ACCCTGAAGT TCATCTGCAC CACCGGCAAG CTGCCCGTGC CCTGGCCCAC 
0181 CCTCGTGACC ACCCTGACCT ACGGCGTGCA GTGCT-TCAG CCGCTACCCC GACCACATGA 
0241 AGCAGCACGA CTTCTTCAAG TCCGCCATGC CCGAAGGCTA CGTCCAGGAG CGCACCATCT 
0301 TCTTCAAGGA CGACGGCAAC TACAAGACCC GCGCCGAGGT GAAGTTCGAG GGCGACACCC 
0361 TGGTGAACCG CATCGAGCTG AAGGGCATCG ACTTCAAGGA GGACGGCAAC ATCCTGGGGC 
0421 ACAAGCTGGA GTACAACTAC AACAGCCACA ACGTCTATAT CATGGCCGAC AAGCAGAAGA 
0481 ACGGCATCAA GGTGAACTTC AAG 
 Assemble Data

GFP-IR-1.IR_full       1   ATGGTNANCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGAC 60
                           ||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||
GFP-IR-1.in silico     1   ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGAC 60


GFP-IR-1.IR_full       61  GGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCNGATGCCACCTA 120
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
GFP-IR-1.in silico     61  GGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGC-GATGCCACCTA 120


GFP-IR-1.IR_full       121 CGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GFP-IR-1.in silico     121 CGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCAC 180


GFP-IR-1.IR_full       181 CCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTNTCAGCCGCTACCCCGACCACATGA 240
                           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
GFP-IR-1.in silico     181 CCTCGTGACCACCCTGACCTACGGCGTGCAGTGCT-TCAGCCGCTACCCCGACCACATGA 240


GFP-IR-1.IR_full       241 AGCAGCACGACTTCTTCAAGTCCGCCATACCCGAAGGCTACGTCCAGGAGCGCACCATCT 300
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
GFP-IR-1.in silico     241 AGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCT 300


GFP-IR-1.IR_full       301 TCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GFP-IR-1.in silico     301 TCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCC 360


GFP-IR-1.IR_full       361 TGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GFP-IR-1.in silico     361 TGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGC 420


GFP-IR-1.IR_full       421 ACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GFP-IR-1.in silico     421 ACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGA 480


GFP-IR-1.IR_full       481 ACGGCATCAAGGTGAACTTCAAG 503
                           |||||||||||||||||||||||
GFP-IR-1.in silico     481 ACGGCATCAAGGTGAACTTCAAG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
0   15  NM_169134.1  CG31556-RA (CG31556), mRNA 
0   NM_164574.1  CG3714-RD, transcript variant D (CG3714), mRNA 
0   NM_164573.1  CG3714-RC, transcript variant C (CG3714), mRNA 
0   NM_164575.1  CG3714-RE, transcript variant E (CG3714), mRNA 
0   NM_134974.4  CG3714-RB, transcript variant B (CG3714), mRNA 
0   11  NM_136502.2  CG14762-RA (CG14762), mRNA 
0   NM_134495.2  CG12234-RA (Ranbp21), mRNA 
0   NM_136900.1  CG8859-RA (Cyp6g2), mRNA 
0   15  NM_132335.2  CG12139-RB (CG12139), mRNA 
0   16  NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   16  NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   NM_143572.2  CG12045-RA (CG12045), mRNA 
0   NM_143764.1  CG18031-RA (CG18031), mRNA 
0   NM_135100.2  CG7251-RA (CG7251), mRNA 
0   NM_134519.1  CG11940-RA, transcript variant A (CG11940), mRNA 
0   NM_167957.1  CG12002-RB, transcript variant B (Pxn), mRNA 
0   NM_079549.2  CG7850-RA (puc), mRNA 
0   NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
0   NM_175957.1  CG33002-RA (mRpL27), mRNA 
0   26  NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_142444.1  CG18599-RA (CG18599), mRNA 
0   NM_169233.1  CG9786-RA, transcript variant A (hb), mRNA 
0   NM_169234.1  CG9786-RB, transcript variant B (hb), mRNA 
0   NM_079949.2  CG7586-RA (Mcr), mRNA 
0   NM_167581.2  CG7826-RA, transcript variant A (mnb), mRNA 
0   NM_001032249.1  CG30084-RF, transcript variant F (CG30084), mRNA 
0   NM_135332.2  CG7380-RA (CG7380), mRNA 
0   NM_057495.3  CG5058-RB, transcript variant B (grh), mRNA 
0   NM_137214.3  CG30084-RA, transcript variant A (CG30084), mRNA 
0   NM_145757.2  CG30084-RC, transcript variant C (CG30084), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.