National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID GFP-IR-1 
 Symbol Avic:GFPEGFP  Full Name Green Fluorescent Protein 
 CG No   Old CG No  
 Synonyms GFP, T:GFP 
 Accession No (Link to NCBI) NM_00GFP 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Defaye A, Evans I, Crozatier M, Wood W, Lemaitre B, Leulier F.
Genetic ablation of Drosophila phagocytes reveals their contribution to both development and resistance to bacterial infection.
J Innate Immun (2010) 1(4) 322-34 [ PubMed ID = 20375589 ] [ RRC reference ]

Merkling SH, Riahi H, Overheul GJ, Schenck A, van Rij RP.
Peroxisome-associated Sgroppino links fat metabolism with survival after RNA virus infection in Drosophila.
Sci Rep (2019) 9(1) 2065 [ PubMed ID = 30765784 ] [ RRC reference ]

Phan A, Thomas CI, Chakraborty M, Berry JA, Kamasawa N, Davis RL.
Stromalin Constrains Memory Acquisition by Developmentally Limiting Synaptic Vesicle Pool Size.
Neuron (2018) [ PubMed ID = 30503644 ] [ RRC reference ]

Morán T, Bernués J, Azorín F.
The Drosophila histone demethylase dKDM5/LID regulates hematopoietic development.
Dev. Biol. (2015) 405(2) 260-8 [ PubMed ID = 26183107 ] [ RRC reference ]

Leulier F, Vidal S, Saigo K, Ueda R, Lemaitre B.
Inducible expression of double-stranded RNA reveals a role for dFADD in the regulation of the antibacterial response in Drosophila adults.
Curr. Biol. (2002) 12(12) 996-1000 [ PubMed ID = 12123572 ] [ RRC reference ]

Poernbacher I, Vincent JP.
Epithelial cells release adenosine to promote local TNF production in response to polarity disruption.
Nat Commun (2018) 9(1) 4675 [ PubMed ID = 30405122 ] [ RRC reference ]

Leulier F, Ribeiro PS, Palmer E, Tenev T, Takahashi K, Robertson D, Zachariou A, Pichaud F, Ueda R, Meier P.
Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery.
Cell Death Differ. (2006) 13(10) 1663-74 [ PubMed ID = 16485033 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| silico     61  GGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGC-GATGCCACCTA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCAC 180

                           ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| silico     181 CCTCGTGACCACCCTGACCTACGGCGTGCAGTGCT-TCAGCCGCTACCCCGACCACATGA 240

                           |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     241 AGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGA 480

                           ||||||||||||||||||||||| silico     481 ACGGCATCAAGGTGAACTTCAAG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
0   15  NM_169134.1  CG31556-RA (CG31556), mRNA 
0   NM_164574.1  CG3714-RD, transcript variant D (CG3714), mRNA 
0   NM_164573.1  CG3714-RC, transcript variant C (CG3714), mRNA 
0   NM_164575.1  CG3714-RE, transcript variant E (CG3714), mRNA 
0   NM_134974.4  CG3714-RB, transcript variant B (CG3714), mRNA 
0   11  NM_136502.2  CG14762-RA (CG14762), mRNA 
0   NM_134495.2  CG12234-RA (Ranbp21), mRNA 
0   NM_136900.1  CG8859-RA (Cyp6g2), mRNA 
0   15  NM_132335.2  CG12139-RB (CG12139), mRNA 
0   16  NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   16  NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   NM_143572.2  CG12045-RA (CG12045), mRNA 
0   NM_143764.1  CG18031-RA (CG18031), mRNA 
0   NM_135100.2  CG7251-RA (CG7251), mRNA 
0   NM_134519.1  CG11940-RA, transcript variant A (CG11940), mRNA 
0   NM_167957.1  CG12002-RB, transcript variant B (Pxn), mRNA 
0   NM_079549.2  CG7850-RA (puc), mRNA 
0   NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
0   NM_175957.1  CG33002-RA (mRpL27), mRNA 
0   26  NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_142444.1  CG18599-RA (CG18599), mRNA 
0   NM_169233.1  CG9786-RA, transcript variant A (hb), mRNA 
0   NM_169234.1  CG9786-RB, transcript variant B (hb), mRNA 
0   NM_079949.2  CG7586-RA (Mcr), mRNA 
0   NM_167581.2  CG7826-RA, transcript variant A (mnb), mRNA 
0   NM_001032249.1  CG30084-RF, transcript variant F (CG30084), mRNA 
0   NM_135332.2  CG7380-RA (CG7380), mRNA 
0   NM_057495.3  CG5058-RB, transcript variant B (grh), mRNA 
0   NM_137214.3  CG30084-RA, transcript variant A (CG30084), mRNA 
0   NM_145757.2  CG30084-RC, transcript variant C (CG30084), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.