National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9996R-2 
 Symbol CG9996  Full Name CG9996 
 CG No CG9996  Old CG No CG9996 
 Synonyms CG9996 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGGGAAACCCCCGCTTTACA 
 Primer Seq. 3'
aatctagaggtaccGCCGGAATTAACGCCCAGTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGGNAAACC CCCGCTTTAC ATCGTGGTGG TCTCCTGCGG TCAGAGGGTG CAGGAGACTC 
0061 TGGTTATGAT TAAGTCAGCC ATTCTGTTCA ACTACGACGA GGAGTACCTC AAGTTTGTGA 
0121 TCTTCACGGA GGACGGGAAG GGTGATGAGT TCAGGGAAAA GTTGACCGAC TGGCGCGATA 
0181 TCAAGCCGTT TACATTTGAC TTTGAGATTT TGCCACTGAA GTTTCCCAGT GGCAATGAAG 
0241 TCGAGTGGAG GAATCTCTTT AAGCCATGTG CAGCTCAACG TCTCTTTTTG CCGTCATTGC 
0301 TAACGCATGT GGACTCATTG CTGTATGTGG ACACGGATAT ATTGTTTTTG TCGCCCATCT 
0361 CAGATATCTG GCGATTCNTT AAGAAGTTCA ATGAGACGCA AATGTCCGCA CTGACGCCCG 
0421 AGCACGAGAA CGAAAACATT GGCTGGTACA ATAGATTTGC ACGACATCCA TTCTATGGCC 
0481 GACTGGGCGT TAATT 
 in silico PCR Fragment
0001 ctgggaaacc cccgctttac atcgtggtgg tctcctgcgg tcagagggtg caggagactc 
0061 tggttatgat taagtcagcc attctgttca actacgacga ggagtacctc aagtttgtga 
0121 tcttcacgga ggacgggaag ggtgatgagt tcagggaaaa gttgaccgac tggcgcgata 
0181 tcaagccgtt tacatttgac tttgagattt tgccactgaa gtttcccagt ggcaatgaag 
0241 tcgagtggag gaatctcttt aagccatgtg cagctcaacg tctctttttg ccgtcattgc 
0301 taacgcatgt ggactcattg ctgtatgtgg acacggatat attgtttttg tcgcccatct 
0361 cggatatctg gcgattcttt aagaagttca atgagacgca aatgtccgca ctgacgcccg 
0421 agcacgagaa cgaaaacatt ggctggtaca atagatttgc acgacatcca ttctatggcc 
0481 gactgggcgt taattccggc  
 Assemble Data

9996R-2.IR full       1   CTGGNAAACCCCCGCTTTACATCGTGGTGGTCTCCTGCGGTCAGAGGGTGCAGGAGACTC 60
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-2.in silico     1   CTGGGAAACCCCCGCTTTACATCGTGGTGGTCTCCTGCGGTCAGAGGGTGCAGGAGACTC 60


9996R-2.IR full       61  TGGTTATGATTAAGTCAGCCATTCTGTTCAACTACGACGAGGAGTACCTCAAGTTTGTGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-2.in silico     61  TGGTTATGATTAAGTCAGCCATTCTGTTCAACTACGACGAGGAGTACCTCAAGTTTGTGA 120


9996R-2.IR full       121 TCTTCACGGAGGACGGGAAGGGTGATGAGTTCAGGGAAAAGTTGACCGACTGGCGCGATA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-2.in silico     121 TCTTCACGGAGGACGGGAAGGGTGATGAGTTCAGGGAAAAGTTGACCGACTGGCGCGATA 180


9996R-2.IR full       181 TCAAGCCGTTTACATTTGACTTTGAGATTTTGCCACTGAAGTTTCCCAGTGGCAATGAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-2.in silico     181 TCAAGCCGTTTACATTTGACTTTGAGATTTTGCCACTGAAGTTTCCCAGTGGCAATGAAG 240


9996R-2.IR full       241 TCGAGTGGAGGAATCTCTTTAAGCCATGTGCAGCTCAACGTCTCTTTTTGCCGTCATTGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-2.in silico     241 TCGAGTGGAGGAATCTCTTTAAGCCATGTGCAGCTCAACGTCTCTTTTTGCCGTCATTGC 300


9996R-2.IR full       301 TAACGCATGTGGACTCATTGCTGTATGTGGACACGGATATATTGTTTTTGTCGCCCATCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-2.in silico     301 TAACGCATGTGGACTCATTGCTGTATGTGGACACGGATATATTGTTTTTGTCGCCCATCT 360


9996R-2.IR full       361 CAGATATCTGGCGATTCNTTAAGAAGTTCAATGAGACGCAAATGTCCGCACTGACGCCCG 420
                          | ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
9996R-2.in silico     361 CGGATATCTGGCGATTCTTTAAGAAGTTCAATGAGACGCAAATGTCCGCACTGACGCCCG 420


9996R-2.IR full       421 AGCACGAGAACGAAAACATTGGCTGGTACAATAGATTTGCACGACATCCATTCTATGGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-2.in silico     421 AGCACGAGAACGAAAACATTGGCTGGTACAATAGATTTGCACGACATCCATTCTATGGCC 480


9996R-2.IR full       481 GACTGGGCGTTAATT----- 500
                          |||||||||||||||     
9996R-2.in silico     481 GACTGGGCGTTAATTCCGGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.