National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9996R-1 
 Symbol CG9996  Full Name CG9996 
 CG No CG9996  Old CG No CG9996 
 Synonyms CG9996 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGGGAAACCCCCGCTTTACA 
 Primer Seq. 3'
aatctagaggtaccGCCGGAATTAACGCCCAGTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

9996R-1.IR full       1   CTGGNAAACCCCCGCTTTACATCGTGGTGGTCTCCTGCGGTCAGAGGGTGCAGGAGACTC 60
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-1.in silico     1   CTGGGAAACCCCCGCTTTACATCGTGGTGGTCTCCTGCGGTCAGAGGGTGCAGGAGACTC 60


9996R-1.IR full       61  TGGTTATGATTAAGTCAGCCATTCTGTTCAACTACGACGAGGAGTACCTCAAGTTTGTGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-1.in silico     61  TGGTTATGATTAAGTCAGCCATTCTGTTCAACTACGACGAGGAGTACCTCAAGTTTGTGA 120


9996R-1.IR full       121 TCTTCACGGAGGACGGGAAGGGTGATGAGTTCAGGGAAAAGTTGACCGACTGGCGCGATA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-1.in silico     121 TCTTCACGGAGGACGGGAAGGGTGATGAGTTCAGGGAAAAGTTGACCGACTGGCGCGATA 180


9996R-1.IR full       181 TCAAGCCGTTTACATTTGACTTTGAGATTTTGCCACTGAAGTTTCCCAGTGGCAATGAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-1.in silico     181 TCAAGCCGTTTACATTTGACTTTGAGATTTTGCCACTGAAGTTTCCCAGTGGCAATGAAG 240


9996R-1.IR full       241 TCGAGTGGAGGAATCTCTTTAAGCCATGTGCAGCTCAACGTCTCTTTTTGCCGTCATTGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-1.in silico     241 TCGAGTGGAGGAATCTCTTTAAGCCATGTGCAGCTCAACGTCTCTTTTTGCCGTCATTGC 300


9996R-1.IR full       301 TAACGCATGTGGACTCATTGCTGTATGTGGACACGGATATATTGTTTTTGTCGCCCATCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-1.in silico     301 TAACGCATGTGGACTCATTGCTGTATGTGGACACGGATATATTGTTTTTGTCGCCCATCT 360


9996R-1.IR full       361 CAGATATCTGGCGATTCNTTAAGAAGTTCAATGAGACGCAAATGTCCGCACTGACGCCCG 420
                          | ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
9996R-1.in silico     361 CGGATATCTGGCGATTCTTTAAGAAGTTCAATGAGACGCAAATGTCCGCACTGACGCCCG 420


9996R-1.IR full       421 AGCACGAGAACGAAAACATTGGCTGGTACAATAGATTTGCACGACATCCATTCTATGGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9996R-1.in silico     421 AGCACGAGAACGAAAACATTGGCTGGTACAATAGATTTGCACGACATCCATTCTATGGCC 480


9996R-1.IR full       481 GACTGGGCGTTAATT----- 500
                          |||||||||||||||     
9996R-1.in silico     481 GACTGGGCGTTAATTCCGGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.