National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9968R-1 
 Symbol Anxb11  Full Name Annexin B11 
 CG No CG9968  Old CG No CG9968 
 Synonyms CG9968, BcDNA:GH16395, Anxb11, AnxB11, annexin 
 Accession No (Link to NCBI) NM_078646.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGAGATCCAGCGCCAGTTCA 
 Primer Seq. 3'
aatctagaggtaccAGTCATGCCCTCGTACTCTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGAGATCCA GCGCCAGTTC AAGACGCACT TCGGCAAGGA CCTCATCGAG NACATCAAGT 
0061 CGGAGNNNNG CGGCAACTTT GAGAAACTCC TCGTCGGCCT GCTGCGTCCC ATCGTGGACT 
0121 ACTACTGCGC CGAGCTAAAC GATGCCATGG CTGGCCTGGG CACCGACGAG GAGGTCCTCA 
0181 TCGAGATCCT CTGCACGCTG TCCAACATGG AGATCAATAC GATCAAAAAC CAGTACTTAC 
0241 GATTGTACGG CGCCCATTTG GAGTCTGAAC TAAAGTCGGA GACGTCGGGC AACTTTAAGC 
0301 GGCTGCTTAC CTCCTTGTGC ACGGCGGCNC GGGATGAGAG TGGTCGCGTG GATCCCGTGG 
0361 CGGCCAAGAA CGATGCTAGG GAGCTACTGA AAGCCGGCGA ACTGCGCGTC GGCACCGATG 
0421 AGAGCATGTT CAACATGATC CTCTGCCAGA GGAACTATCA GCAATTGAAA CTGATATTCC 
0481 AAGAGTACGA GGGCATGACT  
 in silico PCR Fragment
0001 AGGAGATCCA GCGCCAGTTC AAGACGCACT TCGGCAAGGA CCTCATCGAG GACATCAAGT 
0061 CGGAGACGAG CGGCAACTTT GAGAAACTCC TCGTCGGCCT GCTGCGTCCC ATCGTGGACT 
0121 ACTACTGCGC CGAGCTAAAC GATGCCATGG CTGGCCTGGG CACCGACGAG GAGGTCCTCA 
0181 TCGAGATCCT CTGCACGCTG TCCAACATGG AGATCAATAC GATCAAAAAC CAGTACTTAC 
0241 GATTGTACGG CGCCCATTTG GAGTCTGAAC TAAAGTCGGA GACGTCGGGC AACTTTAAGC 
0301 GGCTGCTTAC CTCCTTGTGC ACGGCGGCGC GGGATGAGAG TGGTCGCGTG GATCCCGTGG 
0361 CGGCCAAGAA CGATGCTAGG GAGCTACTGA AAGCCGGCGA ACTGCGCGTC GGCACCGATG 
0421 AGAGCATGTT CAACATGATC CTCTGCCAGA GGAACTATCA GCAATTGAAA CTGATATTCC 
0481 AAGAGTACGA GGGCATGACT  
 Assemble Data

9968R-1.IR_full       1   AGGAGATCCAGCGCCAGTTCAAGACGCACTTCGGCAAGGACCTCATCGAGNACATCAAGT 60
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
9968R-1.in silico     1   AGGAGATCCAGCGCCAGTTCAAGACGCACTTCGGCAAGGACCTCATCGAGGACATCAAGT 60


9968R-1.IR_full       61  CGGAGNNNNGCGGCAACTTTGAGAAACTCCTCGTCGGCCTGCTGCGTCCCATCGTGGACT 120
                          |||||    |||||||||||||||||||||||||||||||||||||||||||||||||||
9968R-1.in silico     61  CGGAGACGAGCGGCAACTTTGAGAAACTCCTCGTCGGCCTGCTGCGTCCCATCGTGGACT 120


9968R-1.IR_full       121 ACTACTGCGCCGAGCTAAACGATGCCATGGCTGGCCTGGGCACCGACGAGGAGGTCCTCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9968R-1.in silico     121 ACTACTGCGCCGAGCTAAACGATGCCATGGCTGGCCTGGGCACCGACGAGGAGGTCCTCA 180


9968R-1.IR_full       181 TCGAGATCCTCTGCACGCTGTCCAACATGGAGATCAATACGATCAAAAACCAGTACTTAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9968R-1.in silico     181 TCGAGATCCTCTGCACGCTGTCCAACATGGAGATCAATACGATCAAAAACCAGTACTTAC 240


9968R-1.IR_full       241 GATTGTACGGCGCCCATTTGGAGTCTGAACTAAAGTCGGAGACGTCGGGCAACTTTAAGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9968R-1.in silico     241 GATTGTACGGCGCCCATTTGGAGTCTGAACTAAAGTCGGAGACGTCGGGCAACTTTAAGC 300


9968R-1.IR_full       301 GGCTGCTTACCTCCTTGTGCACGGCGGCNCGGGATGAGAGTGGTCGCGTGGATCCCGTGG 360
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
9968R-1.in silico     301 GGCTGCTTACCTCCTTGTGCACGGCGGCGCGGGATGAGAGTGGTCGCGTGGATCCCGTGG 360


9968R-1.IR_full       361 CGGCCAAGAACGATGCTAGGGAGCTACTGAAAGCCGGCGAACTGCGCGTCGGCACCGATG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9968R-1.in silico     361 CGGCCAAGAACGATGCTAGGGAGCTACTGAAAGCCGGCGAACTGCGCGTCGGCACCGATG 420


9968R-1.IR_full       421 AGAGCATGTTCAACATGATCCTCTGCCAGAGGAACTATCAGCAATTGAAACTGATATTCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9968R-1.in silico     421 AGAGCATGTTCAACATGATCCTCTGCCAGAGGAACTATCAGCAATTGAAACTGATATTCC 480


9968R-1.IR_full       481 AAGAGTACGAGGGCATGACT 500
                          ||||||||||||||||||||
9968R-1.in silico     481 AAGAGTACGAGGGCATGACT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  18  NM_078646.2  CG9968-RA, transcript variant A (Anxb11), mRNA 
100   482  18  NM_167519.1  CG9968-RB, transcript variant B (Anxb11), mRNA 
2.28   11  21  46  NM_206531.1  CG5730-RC, transcript variant C (AnnIX), mRNA 
2.28   11  21  46  NM_057256.3  CG5730-RA, transcript variant A (AnnIX), mRNA 
2.28   11  21  46  NM_057255.2  CG5730-RB, transcript variant B (AnnIX), mRNA 
2.28   11  21  46  NM_206530.1  CG5730-RD, transcript variant D (AnnIX), mRNA 
0   NM_132791.2  CG12608-RA (CG12608), mRNA 
0   NM_058089.3  CG6213-RA (Vha13), mRNA 
0   NM_167169.1  CG10701-RA, transcript variant A (Moe), mRNA 
0   NM_167168.1  CG10701-RB, transcript variant B (Moe), mRNA 
0   NM_080343.2  CG10701-RD, transcript variant D (Moe), mRNA 
0   NM_206664.1  CG10701-RJ, transcript variant J (Moe), mRNA 
0   NM_206665.1  CG10701-RI, transcript variant I (Moe), mRNA 
0   NM_206669.1  CG10701-RE, transcript variant E (Moe), mRNA 
0   NM_206666.1  CG10701-RH, transcript variant H (Moe), mRNA 
0   NM_206668.1  CG10701-RF, transcript variant F (Moe), mRNA 
0   NM_206667.1  CG10701-RG, transcript variant G (Moe), mRNA 
0   NM_167170.1  CG10701-RC, transcript variant C (Moe), mRNA 
0   NM_168757.1  CG8127-RD, transcript variant D (Eip75B), mRNA 
0   NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 
0   NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   NM_168756.1  CG8127-RC, transcript variant C (Eip75B), mRNA 
0   NM_138249.2  CG9139-RA (CG9139), mRNA 
0   NM_141867.2  CG6962-RA (CG6962), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   22  NM_175960.3  CG33196-RB (dp), mRNA 
0   18  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   17  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_001038856.1  CG8585-RC, transcript variant C (Ih), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.