National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9960R-2 
 Symbol CG9960  Full Name CG9960 
 CG No CG9960  Old CG No CG9960 
 Synonyms CG32951, CG9960 
 Accession No (Link to NCBI)  
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees  
 Map Viewer
 Reference
[Please submit your publication]
Obata F, Tsuda-Sakurai K, Yamazaki T, Nishio R, Nishimura K, Kimura M, Funakoshi M, Miura M.
Nutritional Control of Stem Cell Division through S-Adenosylmethionine in Drosophila Intestine.
Dev. Cell (2018) 44(6) 741-751.e3 [ PubMed ID = 29587144 ] [ RRC reference ]  
 Comment balanced with FM7c 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGAGCACGTTTACGAGCCAG 
 Primer Seq. 3'
aatctagaggtaccCAGCAGGAGTAGGTAGAGCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

9960R-2.IR full       1   TCGAGCACGTTTACGAGCCAGCGGAAGACTCGTTCCTGCTGCTGGATGCCCTGGAAAAGG 60
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
9960R-2.in silico     1   TCGAGCACGTTTACGAGCCAGCGGAGGACTCGTTCCTGCTGCTGGATGCCCTGGAAAAGG 60


9960R-2.IR full       61  ATCTGGAGTACCTGGACCGGCTACAGCCGAGTCTCTGCGTCGAACTGGGCTCCGGTTCGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9960R-2.in silico     61  ATCTGGAGTACCTGGACCGGCTACAGCCGAGTCTCTGCGTCGAACTGGGCTCCGGTTCGG 120


9960R-2.IR full       121 GTGTGATCATCACGGCGCTGGCCAAGAAACTGGCTGGCTTTTCGCTGTGCCTAGCTACGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9960R-2.in silico     121 GTGTGATCATCACGGCGCTGGCCAAGAAACTGGCTGGCTTTTCGCTGTGCCTAGCTACGG 180


9960R-2.IR full       181 ATATCAATCCCAAAGCCTGCAATGCCACTCGAAGAACTGCGACTCGGAATGGCGCTCGCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9960R-2.in silico     181 ATATCAATCCCAAAGCCTGCAATGCCACTCGAAGAACTGCGACTCGGAATGGCGCTCGCT 240


9960R-2.IR full       241 TGGATAGCATTCGCTGCAGCCTAGCGGATGCACTGCGCCCGCGATCCGTTGACGTGCTGC 300
                          ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||
9960R-2.in silico     241 TGGATAGCATTCGCTGCAGCCTAGCGGATGCACTGCGTCCGCGATCCGTGGACGTGCTGC 300


9960R-2.IR full       301 TCTTCAATCCGCCCTATGTAGTCACCAGTGACGAGGAGCTGCAGACGCAACAGTTCGATT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9960R-2.in silico     301 TCTTCAATCCGCCCTATGTAGTCACCAGTGACGAGGAGCTGCAGACGCAACAGTTCGATT 360


9960R-2.IR full       361 CGCACAGCGAATCCTCAACGGATCGCAATCTGGTTTTCTCCTGGGCTGGTGGACAGGACG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9960R-2.in silico     361 CGCACAGCGAATCCTCAACGGATCGCAATCTGGTTTTCTCCTGGGCTGGTGGACAGGACG 420


9960R-2.IR full       421 GGCGACGCGTCACGGACATTCTACTCAAGCAATTGGATGACATTCTTTCGCCTCGAGGCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9960R-2.in silico     421 GGCGACGCGTCACGGACATTCTACTCAAGCAATTGGATGACATTCTTTCGCCTCGAGGCG 480


9960R-2.IR full       481 TGCTCTACCTACTCCTGCTG 500
                          ||||||||||||||||||||
9960R-2.in silico     481 TGCTCTACCTACTCCTGCTG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.