National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9952R-2 
 Symbol ppa  Full Name partner of paired 
 CG No CG9952  Old CG No CG9952 
 Synonyms CG9952, Ppa, I-55, ppa 
 Accession No (Link to NCBI) NM_079088.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Moreno-Moreno O, Torras-Llort M, Azorin F.
The E3-ligases SCFPpa and APC/CCdh1 co-operate to regulate CENP-ACID expression across the cell cycle.
Nucleic Acids Res. (2019) [ PubMed ID = 30753559 ] [ RRC reference ]

Dui W, Lu W, Ma J, Jiao R.
A systematic phenotypic screen of F-box genes through a tissue-specific RNAi-based approach in Drosophila.
J Genet Genomics (2012) 39(8) 397-413 [ PubMed ID = 22884096 ] [ RRC reference ]

Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAGCTGCTGCCCTTCCATCA 
 Primer Seq. 3'
aatctagaggtaccCCCGACCCAAATCCCTCACTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAGCTGCTG CCCTTCCATC ATCAAACAAT CGCGGTGTTG AACAATCTGA ATAGCCACTG 
0061 TGGCGGATCC GGGAGCAACG GAGCGGCCAC CAGTGGCGGC GCGGCGATTG GCGGAGCAGG 
0121 AGCCGGAGGA GCGCCCAGCT GGGCCATGGA CGAACTCTAT CAACAGACTG AGCTGCCCGG 
0181 TCTGACGCGA ACCGGAGCCA CCACCACCCA CCACCACCTG CTGCGCTTCA CGCCCTACGC 
0241 CCTGCACCAC CGACCGCCGC ACCACCAGCT GCAGACCTTG CCGCCGGCCC TCTACTTGCA 
0301 GCATGCCGCA GCAgCTGCGG CGGCAGCGGC AGCAGCAGCg GCCCACGCCC AGCACCATCA 
0361 TCACCATCAC CACCATCTCC CGCACAGACC AGCATCTCCG GAGAGCCCGC CGCCGGTGGA 
0421 GGGCACCCAC ATAAGCAACC TGTTCCCAGA ACTCCTCGAG CAGATATTCG AGCACCTACC 
0481 AGTGAGGGAT TTGGGTCGGG  
 in silico PCR Fragment
0001 GGAGCTGCTG CCCTTCCATC ATCAAACAAT CGCGGTGTTG AACAATCTGA ATAGCCACTG 
0061 TGGCGGATCC GGGAGCAACG GAGCGGCCAC CAGTGGCGGC GCGGCGATTG GCGGAGCAGG 
0121 AGCCGGAGGA GCGCCCAGCT GGGCCATGGA CGAACTCTAT CAACAGACTG AGCTGCCCGG 
0181 TCTGACGCGA ACCGGAGCCA CCACCACCCA CCACCACCTG CTGCGCTTCA CGCCCTACGC 
0241 CCTGCACCAC CGACCGCCGC ACCACCAGCT GCAGACCTTG CCGCCGGCCC TCTACTTGCA 
0301 GCATGCCGCA GCAGCTGCGG CGGCAGCGGC AGCAGCAGCG GCCCACGCCC AGCACCATCA 
0361 TCACCATCAC CACCATCTCC CGCACAGACC AGCATCTCCG GAGAGCCCGC CGCCGGTGGA 
0421 GGGCACCCAC ATAAGCAACC TGTTCCCAGA ACTCCTCGAG CAGATATTCG AGCACCTACC 
0481 AGTGAGGGAT TTGGGTCGGG  
 Assemble Data

9952R-2.IR_full       1   GGAGCTGCTGCCCTTCCATCATCAAACAATCGCGGTGTTGAACAATCTGAATAGCCACTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9952R-2.in silico     1   GGAGCTGCTGCCCTTCCATCATCAAACAATCGCGGTGTTGAACAATCTGAATAGCCACTG 60


9952R-2.IR_full       61  TGGCGGATCCGGGAGCAACGGAGCGGCCACCAGTGGCGGCGCGGCGATTGGCGGAGCAGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9952R-2.in silico     61  TGGCGGATCCGGGAGCAACGGAGCGGCCACCAGTGGCGGCGCGGCGATTGGCGGAGCAGG 120


9952R-2.IR_full       121 AGCCGGAGGAGCGCCCAGCTGGGCCATGGACGAACTCTATCAACAGACTGAGCTGCCCGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9952R-2.in silico     121 AGCCGGAGGAGCGCCCAGCTGGGCCATGGACGAACTCTATCAACAGACTGAGCTGCCCGG 180


9952R-2.IR_full       181 TCTGACGCGAACCGGAGCCACCACCACCCACCACCACCTGCTGCGCTTCACGCCCTACGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9952R-2.in silico     181 TCTGACGCGAACCGGAGCCACCACCACCCACCACCACCTGCTGCGCTTCACGCCCTACGC 240


9952R-2.IR_full       241 CCTGCACCACCGACCGCCGCACCACCAGCTGCAGACCTTGCCGCCGGCCCTCTACTTGCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9952R-2.in silico     241 CCTGCACCACCGACCGCCGCACCACCAGCTGCAGACCTTGCCGCCGGCCCTCTACTTGCA 300


9952R-2.IR_full       301 GCATGCCGCAGCAGCTGCGGCGGCAGCGGCAGCAGCAGCGGCCCACGCCCAGCACCATCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9952R-2.in silico     301 GCATGCCGCAGCAGCTGCGGCGGCAGCGGCAGCAGCAGCGGCCCACGCCCAGCACCATCA 360


9952R-2.IR_full       361 TCACCATCACCACCATCTCCCGCACAGACCAGCATCTCCGGAGAGCCCGCCGCCGGTGGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9952R-2.in silico     361 TCACCATCACCACCATCTCCCGCACAGACCAGCATCTCCGGAGAGCCCGCCGCCGGTGGA 420


9952R-2.IR_full       421 GGGCACCCACATAAGCAACCTGTTCCCAGAACTCCTCGAGCAGATATTCGAGCACCTACC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9952R-2.in silico     421 GGGCACCCACATAAGCAACCTGTTCCCAGAACTCCTCGAGCAGATATTCGAGCACCTACC 480


9952R-2.IR_full       481 AGTGAGGGATTTGGGTCGGG 500
                          ||||||||||||||||||||
9952R-2.in silico     481 AGTGAGGGATTTGGGTCGGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  35  NM_079088.2  CG9952-RA (ppa), mRNA 
1.65   39  41  204  NM_169696.1  CG3992-RA, transcript variant A (srp), mRNA 
1.65   39  41  204  NM_169694.1  CG3992-RB, transcript variant B (srp), mRNA 
1.65   10  21  72  NM_132479.2  CG1597-RA (CG1597), mRNA 
1.03   72  326  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
1.03   64  289  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
1.03   62  NM_169170.1  CG1070-RC, transcript variant C (Alh), mRNA 
1.03   37  NM_169172.1  CG1070-RB, transcript variant B (Alh), mRNA 
1.03   35  NM_079526.2  CG1070-RA, transcript variant A (Alh), mRNA 
1.03   35  NM_169171.1  CG1070-RD, transcript variant D (Alh), mRNA 
0.82   19  72  NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
0.82   13  36  NM_143285.1  CG6051-RA (CG6051), mRNA 
0.82   22  NM_206161.1  CG5580-RB, transcript variant B (sbb), mRNA 
0.82   21  NM_206162.1  CG5580-RC, transcript variant C (sbb), mRNA 
0.82   13  41  NM_170247.1  CG17367-RC, transcript variant C (Lnk), mRNA 
0.82   13  41  NM_170246.1  CG17367-RA, transcript variant A (Lnk), mRNA 
0.82   13  41  NM_143181.2  CG17367-RB, transcript variant B (Lnk), mRNA 
0.62   12  32  NM_079736.2  CG10868-RA, transcript variant A (orb), mRNA 
0.62   12  24  NM_170063.2  CG10868-RD, transcript variant D (orb), mRNA 
0.62   12  24  NM_170062.1  CG10868-RB, transcript variant B (orb), mRNA 
0.62   45  145  NM_001014590.1  CG32180-RD, transcript variant D (Eip74EF), mRNA 
0.62   45  145  NM_168741.2  CG32180-RB, transcript variant B (Eip74EF), mRNA 
0.62   42  128  NM_168740.2  CG32180-RA, transcript variant A (Eip74EF), mRNA 
0.62   42  128  NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 
0.62   39  215  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0.62   39  215  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0.62   39  215  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0.62   28  146  NM_169260.1  CG9755-RB, transcript variant B (pum), mRNA 
0.62   28  146  NM_176427.1  CG9755-RE, transcript variant E (pum), mRNA 
0.62   37  NM_057826.3  CG10043-RA, transcript variant A (rtGEF), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.