National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9936R-3 
 Symbol skd  Full Name skuld 
 CG No CG9936  Old CG No CG9936 
 Synonyms TRAP240, dmMED13, pap, MED13, Skd/Pap/Bli, LD28662, Pap/Trap, Pap, SPH203, bli, Srb9/AMIB/PAP/TRAP240, dTRAP240, Scad78, pap/dTRAP240, bls, l(3)rK760, Skd/Med13, l(3)L7062, CG9936, skd, skuld, blind spot, flytrap, poils aux pattes, Suppressor of constitutively activated Dpp signaling 78, Mediator complex subunit 13, Trap240, Skd 
 Accession No (Link to NCBI) NM_168879.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Mao F, Yang X, Fu L, Lv X, Zhang Z, Wu W, Yang S, Zhou Z, Zhang L, Zhao Y.
The Kto-Skd complex can regulate ptc expression by interacting with Cubitus interruptus (Ci) in the Hedgehog signaling pathway.
J. Biol. Chem. (2014) 289(32) 22333-41 [ PubMed ID = 24962581 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGCATCCAGGCGGACATGCTGTGCGTGTGGAGGAGGGTCCAATCCACGAAGACGGACCA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGCCGACCCGAATGCCTTAACCTTCGAGATGACCACGTCGACCAAGGTCCACCCGCCCCT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTCGCTGGCCGCCGCCAAGGAGCTATGGATCTTCTGGTACGGCGAGGAGCCCGATCTCAG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGAACTGGTCGATGCCGAGCTGCTCCGAGTAGCGGCCAACCAAGCGCTTTGGAATGGCAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTGGAAAGGAGCTCTCACCTACGAGTGCCGGTCGCTGCTCTTTAAGGCGCTGCACAATCT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CATGGAGAGATTCGTGCTTACCAAGGACATTGTGCGCTTTGGAAAATGGTTTGTGCAGCC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTGCACCTCCAGCGATCGCCTCTTTGGACGCAGCTCCCAGCACTTGTCCTTCTCATTTAC 420

                          ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| silico     421 GTTCTTTGTGCACGGCGACACCGTTTGTGCCTCCATAGATTTGCGCGAG-CATCCCGCCG 480

                          |||||||||||||||||||||||||||||| silico     481 TGCGTCCGCTGACCAAGGAGCACTTGACCG 510

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   491  NM_079914.2  CG9936-RD, transcript variant D (skd), mRNA 
100   491  NM_168879.2  CG9936-RC, transcript variant C (skd), mRNA 
0.2   NM_170157.1  CG6668-RB, transcript variant B (atl), mRNA 
0.2   NM_143017.2  CG6668-RA, transcript variant A (atl), mRNA 
0.2   NM_137042.2  CG6155-RA (Roe1), mRNA 
0   NM_166889.1  CG14792-RB, transcript variant B (sta), mRNA 
0   NM_057402.3  CG14792-RA, transcript variant A (sta), mRNA 
0   NM_166890.1  CG14792-RD, transcript variant D (sta), mRNA 
0   NM_164509.2  CG2991-RA, transcript variant A (CG2991), mRNA 
0   NM_164510.2  CG2991-RC, transcript variant C (CG2991), mRNA 
0   NM_134881.5  CG2991-RB, transcript variant B (CG2991), mRNA 
0   NM_164322.1  CG14642-RB, transcript variant B (CG14642), mRNA 
0   NM_141184.2  CG14642-RA, transcript variant A (CG14642), mRNA 
0   NM_136253.2  CG9241-RA (Mcm10), mRNA 
0   10  NM_169136.1  CG10295-RA, transcript variant A (Pak), mRNA 
0   10  NM_079942.3  CG10295-RB, transcript variant B (Pak), mRNA 
0   10  NM_169137.1  CG10295-RC, transcript variant C (Pak), mRNA 
0   NM_137948.1  CG3520-RA (CG3520), mRNA 
0   NM_165646.1  CG8068-RD, transcript variant D (Su(var)2-10), mRNA 
0   NM_165651.1  CG8068-RB, transcript variant B (Su(var)2-10), mRNA 
0   NM_165649.1  CG8068-RC, transcript variant C (Su(var)2-10), mRNA 
0   NM_165650.1  CG8068-RF, transcript variant F (Su(var)2-10), mRNA 
0   NM_165652.1  CG8068-RE, transcript variant E (Su(var)2-10), mRNA 
0   NM_078940.2  CG8068-RA, transcript variant A (Su(var)2-10), mRNA 
0   NM_165648.1  CG8068-RG, transcript variant G (Su(var)2-10), mRNA 
0   NM_165645.1  CG8068-RI, transcript variant I (Su(var)2-10), mRNA 
0   NM_165647.1  CG8068-RH, transcript variant H (Su(var)2-10), mRNA 
0   NM_079593.3  CG17228-RC, transcript variant C (pros), mRNA 
0   NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 
0   NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.