National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9936R-3 
 Symbol skd  Full Name skuld 
 CG No CG9936  Old CG No CG9936 
 Synonyms TRAP240, dmMED13, pap, MED13, Skd/Pap/Bli, LD28662, Pap/Trap, Pap, SPH203, bli, Srb9/AMIB/PAP/TRAP240, dTRAP240, Scad78, pap/dTRAP240, bls, l(3)rK760, Skd/Med13, l(3)L7062, CG9936, skd, skuld, blind spot, flytrap, poils aux pattes, Suppressor of constitutively activated Dpp signaling 78, Mediator complex subunit 13, Trap240, Skd 
 Accession No (Link to NCBI) NM_168879.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Mao F, Yang X, Fu L, Lv X, Zhang Z, Wu W, Yang S, Zhou Z, Zhang L, Zhao Y.
The Kto-Skd complex can regulate ptc expression by interacting with Cubitus interruptus (Ci) in the Hedgehog signaling pathway.
J Biol Chem. (2014) 289(32) 22333-41 [ PubMed ID = 24962581 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCATCCAGGCGGACATGCT 
 Primer Seq. 3'
aatctagaggtaccCGGTCAAGTGCTCCTTGGTCA 
 Predicted Fragment Size
509 
 IR fragment full Seq
0001 ATGCATCCAG GCGGACATGC TGTGCGTGTG GAGGAGGGTC CAATCCACGA AGACGGACCA 
0061 CGCCGACCCG AATGCCTTAA CCTTCGAGAT GACCACGTCG ACCAAGGTCC ACCCGCCCCT 
0121 TTCGCTGGCC GCCGCCAAGG AGCTATGGAT CTTCTGGTAC GGCGAGGAGC CCGATCTCAG 
0181 TGAACTGGTC GATGCCGAGC TGCTCCGAGT AGCGGCCAAC CAAGCGCTTT GGAATGGCAC 
0241 CTGGAAAGGA GCTCTCACCT ACGAGTGCCG GTCGCTGCTC TTTAAGGCGC TGCACAATCT 
0301 CATGGAGAGA TTCGTGCTTA CCAAGGACAT TGTGCGCTTT GGAAAATGGT TTGTGCAGCC 
0361 CTGCACCTCC AGCGATCGCC TCTTTGGACG CAGCTCCCAG CACTTGTCCT TCTCATTTAC 
0421 GTTCTTTGTG CACGGCGACA CCGTTTGTGC CTCCATAGAT TTGCGCGAGT CATCCCGCCG 
0481 TGCGTCCGCT GACCAAGGAG CACTTGACCG  
 in silico PCR Fragment
0001 ATGCATCCAG GCGGACATGC TGTGCGTGTG GAGGAGGGTC CAATCCACGA AGACGGACCA 
0061 CGCCGACCCG AATGCCTTAA CCTTCGAGAT GACCACGTCG ACCAAGGTCC ACCCGCCCCT 
0121 TTCGCTGGCC GCCGCCAAGG AGCTATGGAT CTTCTGGTAC GGCGAGGAGC CCGATCTCAG 
0181 TGAACTGGTC GATGCCGAGC TGCTCCGAGT AGCGGCCAAC CAAGCGCTTT GGAATGGCAC 
0241 CTGGAAAGGA GCTCTCACCT ACGAGTGCCG GTCGCTGCTC TTTAAGGCGC TGCACAATCT 
0301 CATGGAGAGA TTCGTGCTTA CCAAGGACAT TGTGCGCTTT GGAAAATGGT TTGTGCAGCC 
0361 CTGCACCTCC AGCGATCGCC TCTTTGGACG CAGCTCCCAG CACTTGTCCT TCTCATTTAC 
0421 GTTCTTTGTG CACGGCGACA CCGTTTGTGC CTCCATAGAT TTGCGCGAG- CATCCCGCCG 
0481 TGCGTCCGCT GACCAAGGAG CACTTGACCG  
 Assemble Data

9936R-3.IR_full       1   ATGCATCCAGGCGGACATGCTGTGCGTGTGGAGGAGGGTCCAATCCACGAAGACGGACCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9936R-3.in silico     1   ATGCATCCAGGCGGACATGCTGTGCGTGTGGAGGAGGGTCCAATCCACGAAGACGGACCA 60


9936R-3.IR_full       61  CGCCGACCCGAATGCCTTAACCTTCGAGATGACCACGTCGACCAAGGTCCACCCGCCCCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9936R-3.in silico     61  CGCCGACCCGAATGCCTTAACCTTCGAGATGACCACGTCGACCAAGGTCCACCCGCCCCT 120


9936R-3.IR_full       121 TTCGCTGGCCGCCGCCAAGGAGCTATGGATCTTCTGGTACGGCGAGGAGCCCGATCTCAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9936R-3.in silico     121 TTCGCTGGCCGCCGCCAAGGAGCTATGGATCTTCTGGTACGGCGAGGAGCCCGATCTCAG 180


9936R-3.IR_full       181 TGAACTGGTCGATGCCGAGCTGCTCCGAGTAGCGGCCAACCAAGCGCTTTGGAATGGCAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9936R-3.in silico     181 TGAACTGGTCGATGCCGAGCTGCTCCGAGTAGCGGCCAACCAAGCGCTTTGGAATGGCAC 240


9936R-3.IR_full       241 CTGGAAAGGAGCTCTCACCTACGAGTGCCGGTCGCTGCTCTTTAAGGCGCTGCACAATCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9936R-3.in silico     241 CTGGAAAGGAGCTCTCACCTACGAGTGCCGGTCGCTGCTCTTTAAGGCGCTGCACAATCT 300


9936R-3.IR_full       301 CATGGAGAGATTCGTGCTTACCAAGGACATTGTGCGCTTTGGAAAATGGTTTGTGCAGCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9936R-3.in silico     301 CATGGAGAGATTCGTGCTTACCAAGGACATTGTGCGCTTTGGAAAATGGTTTGTGCAGCC 360


9936R-3.IR_full       361 CTGCACCTCCAGCGATCGCCTCTTTGGACGCAGCTCCCAGCACTTGTCCTTCTCATTTAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9936R-3.in silico     361 CTGCACCTCCAGCGATCGCCTCTTTGGACGCAGCTCCCAGCACTTGTCCTTCTCATTTAC 420


9936R-3.IR_full       421 GTTCTTTGTGCACGGCGACACCGTTTGTGCCTCCATAGATTTGCGCGAGTCATCCCGCCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
9936R-3.in silico     421 GTTCTTTGTGCACGGCGACACCGTTTGTGCCTCCATAGATTTGCGCGAG-CATCCCGCCG 480


9936R-3.IR_full       481 TGCGTCCGCTGACCAAGGAGCACTTGACCG 510
                          ||||||||||||||||||||||||||||||
9936R-3.in silico     481 TGCGTCCGCTGACCAAGGAGCACTTGACCG 510

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   491  NM_079914.2  CG9936-RD, transcript variant D (skd), mRNA 
100   491  NM_168879.2  CG9936-RC, transcript variant C (skd), mRNA 
0.2   NM_170157.1  CG6668-RB, transcript variant B (atl), mRNA 
0.2   NM_143017.2  CG6668-RA, transcript variant A (atl), mRNA 
0.2   NM_137042.2  CG6155-RA (Roe1), mRNA 
0   NM_166889.1  CG14792-RB, transcript variant B (sta), mRNA 
0   NM_057402.3  CG14792-RA, transcript variant A (sta), mRNA 
0   NM_166890.1  CG14792-RD, transcript variant D (sta), mRNA 
0   NM_164509.2  CG2991-RA, transcript variant A (CG2991), mRNA 
0   NM_164510.2  CG2991-RC, transcript variant C (CG2991), mRNA 
0   NM_134881.5  CG2991-RB, transcript variant B (CG2991), mRNA 
0   NM_164322.1  CG14642-RB, transcript variant B (CG14642), mRNA 
0   NM_141184.2  CG14642-RA, transcript variant A (CG14642), mRNA 
0   NM_136253.2  CG9241-RA (Mcm10), mRNA 
0   10  NM_169136.1  CG10295-RA, transcript variant A (Pak), mRNA 
0   10  NM_079942.3  CG10295-RB, transcript variant B (Pak), mRNA 
0   10  NM_169137.1  CG10295-RC, transcript variant C (Pak), mRNA 
0   NM_137948.1  CG3520-RA (CG3520), mRNA 
0   NM_165646.1  CG8068-RD, transcript variant D (Su(var)2-10), mRNA 
0   NM_165651.1  CG8068-RB, transcript variant B (Su(var)2-10), mRNA 
0   NM_165649.1  CG8068-RC, transcript variant C (Su(var)2-10), mRNA 
0   NM_165650.1  CG8068-RF, transcript variant F (Su(var)2-10), mRNA 
0   NM_165652.1  CG8068-RE, transcript variant E (Su(var)2-10), mRNA 
0   NM_078940.2  CG8068-RA, transcript variant A (Su(var)2-10), mRNA 
0   NM_165648.1  CG8068-RG, transcript variant G (Su(var)2-10), mRNA 
0   NM_165645.1  CG8068-RI, transcript variant I (Su(var)2-10), mRNA 
0   NM_165647.1  CG8068-RH, transcript variant H (Su(var)2-10), mRNA 
0   NM_079593.3  CG17228-RC, transcript variant C (pros), mRNA 
0   NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 
0   NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.