National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9885R-2 
 Symbol dpp  Full Name decapentaplegic 
 CG No CG9885  Old CG No CG9885 
 Synonyms dpp, Dpp, BMP, DPP, TGF-beta, TGFbeta, Dm-DPP, TGF-b, CG9885, l(2)k17036, unnamed, l(2)10638, l(2)22Fa, shv, M(2)LS1, ho, blk, Tg, M(2)23AB, Hin-d, DPP-C 
 Accession No (Link to NCBI) NM_057963.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Inaki M, Kojima T, Ueda R, Saigo K.
Requirements of high levels of Hedgehog signaling activity for medial-region cell fate determination in Drosophila legs: identification of pxb, a putative Hedgehog signaling attenuator gene repressed along the anterior-posterior compartment boundary.
Mech. Dev. (2002) 116(1-2) 3-18 [ PubMed ID = 12128201 ] [ RRC reference ]

Tseng CY, Su YH, Yang SM, Lin KY, Lai CM, Rastegari E, Amartuvshin O, Cho Y, Cai Y, Hsu HJ.
Smad-Independent BMP Signaling in Somatic Cells Limits the Size of the Germline Stem Cell Pool.
Stem Cell Reports (2018) 11(3) 811-827 [ PubMed ID = 30122445 ] [ RRC reference ]

Sato T, Ogata J, Niki Y.
BMP and Hh signaling affects primordial germ cell division in Drosophila.
Zool. Sci. (2010) 27(10) 804-10 [ PubMed ID = 20887178 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TTTAATCCATTCAGCGAGCCCGCCTCGTTCAGTGATAGTGATAAAAGCCATCGGAGTAAA 60

                          ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| silico     61  ACAAACAAAAAACCTAGCAAAAGTGACGCGAACCGAC-AGTTCAACGAAGTGCATAAGCC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAGAACAGACCAATTAGAAAATTCCAAAAATAAGTCTAAACAATTAGTTAATAAACCCAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCACAACAAAATGGCTGTCAAGGAGCAGAGGAGCCACCACAAGAAGAGCCACCACCATCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAGCCACCAGCCAAAGCAGGCCAGTGCATCCACAGAATCTCATCAATCCTCGTCGATTGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATCAATCTTCGTGGAGGAGCCGACGCTGGTGCTCGACCGCGAGGTGGCCTCCATCAACGT 360

                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| silico     361 GCCCGCCAACG-CCAAGGCCATCATCGCCGAGCAGGGCCCGTCCACCTACAGCAA-GGAG 420

                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| silico     421 GCGCTCATCAAGGACAAGCTGAAGCCAGACCCCTCCAC-TCTAGTCGAGATCGAG-AAGA 480

                          ||||| ||||||||||||||||||| silico     481 GCCTGCTCTCGCTGTTCAACATGAA 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057963.4  CG9885-RA, transcript variant A (dpp), mRNA 
100   482  NM_164485.1  CG9885-RB, transcript variant B (dpp), mRNA 
100   482  NM_164486.1  CG9885-RC, transcript variant C (dpp), mRNA 
100   482  NM_164487.1  CG9885-RD, transcript variant D (dpp), mRNA 
100   482  NM_164488.1  CG9885-RE, transcript variant E (dpp), mRNA 
0.62   NM_165257.1  CG31790-RA (CG31790), mRNA 
0.2   NM_166341.1  CG30127-RA (CG30127), mRNA 
0   NM_137884.2  CG13532-RA (CG13532), mRNA 
0   NM_134729.2  CG4749-RA (CG4749), mRNA 
0   NM_141004.1  CG3680-RA (CG3680), mRNA 
0   NM_169500.1  CG8630-RA (CG8630), mRNA 
0   NM_168473.2  CG32088-RA (CG32088), mRNA 
0   NM_139541.1  CG12017-RA (CG12017), mRNA 
0   NM_169874.1  CG4608-RA (bnl), mRNA 
0   NM_142641.1  CG5434-RA (Srp72), mRNA 
0   NM_001032062.1  CG9515-RA, transcript variant A (CG9515), mRNA 
0   NM_001032063.1  CG9510-RB, transcript variant B (CG9510), mRNA 
0   NM_135413.2  CG9510-RA, transcript variant A (CG9510), mRNA 
0   10  NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_166724.1  CG32005-RA (CG32005), mRNA 
0   NM_140931.1  CG7290-RA (CG7290), mRNA 
0   NM_142919.1  CG10365-RA, transcript variant A (CG10365), mRNA 
0   NM_143367.2  CG10011-RA (CG10011), mRNA 
0   NM_205952.1  CG4128-RD, transcript variant D (nAcRalpha-30D), mRNA 
0   NM_205953.1  CG4128-RE, transcript variant E (nAcRalpha-30D), mRNA 
0   NM_164874.2  CG4128-RA, transcript variant A (nAcRalpha-30D), mRNA 
0   NM_205951.1  CG4128-RB, transcript variant B (nAcRalpha-30D), mRNA 
0   NM_135472.4  CG4128-RC, transcript variant C (nAcRalpha-30D), mRNA 
0   NM_170556.1  CG11525-RC, transcript variant C (CycG), mRNA 
0   NM_137034.2  CG17064-RA (mars), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.