National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9885R-1 
 Symbol dpp  Full Name decapentaplegic 
 CG No CG9885  Old CG No CG9885 
 Synonyms dpp, Dpp, BMP, DPP, TGF-beta, TGFbeta, Dm-DPP, TGF-b, CG9885, l(2)k17036, unnamed, l(2)10638, l(2)22Fa, shv, M(2)LS1, ho, blk, Tg, M(2)23AB, Hin-d, DPP-C 
 Accession No (Link to NCBI) NM_057963.4 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Inaki M, Kojima T, Ueda R, Saigo K.
Requirements of high levels of Hedgehog signaling activity for medial-region cell fate determination in Drosophila legs: identification of pxb, a putative Hedgehog signaling attenuator gene repressed along the anterior-posterior compartment boundary.
Mech. Dev. (2002) 116(1-2) 3-18 [ PubMed ID = 12128201 ] [ RRC reference ]

Sato T, Ogata J, Niki Y.
BMP and Hh signaling affects primordial germ cell division in Drosophila.
Zool. Sci. (2010) 27(10) 804-10 [ PubMed ID = 20887178 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTAATCCATTCAGCGAGCCC 
 Primer Seq. 3'
aatctagaggtaccTTCATGTTGAACAGCGAGAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTTAATCCAT TCAGCGAGCC CGCCTCGTTC AGTGATAGTG ATAAAAGCCA TCGGAGTAAA 
0061 ACAAACAAAA AACCTAGCAA AAGTGACGCG AACCGACAAG TTCAACGAAG TGCATAAGCC 
0121 AAGAACAGAC CAATTAGAAA ATTCCAAAAA TAAGTCTAAA CAATTAGTTA ATAAACCCAA 
0181 CCACAACAAA ATGGCTGTCA AGGAGCAGAG GAGCCACCAC AAGAAGAGCC ACCACCATCG 
0241 CAGCCACCAG CCAAAGCAGG CCAGTGCATC CACAGAATCT CATCAATCCT CGTCGATTGA 
0301 ATCAATCTTC GTGGAGGAGC CGACGCTGGT GCTCGACCGC GAGGTGGCCT CCATCAACGT 
0361 GCCCGCCAAC GCCCAAGGCC ATCATCGCCG AGCAGGGCCC GTCCACCTAC AGCAAGGGAG 
0421 GCGCTCATCA AGGACAAGCT GAAGCCAGAC CCCTCCACTT CTAGTCGAGA TCGAGNAAGA 
0481 GCCTGNTCTC GCTGTTCAAC ATGAA 
 in silico PCR Fragment
0001 TTTAATCCAT TCAGCGAGCC CGCCTCGTTC AGTGATAGTG ATAAAAGCCA TCGGAGTAAA 
0061 ACAAACAAAA AACCTAGCAA AAGTGACGCG AACCGAC-AG TTCAACGAAG TGCATAAGCC 
0121 AAGAACAGAC CAATTAGAAA ATTCCAAAAA TAAGTCTAAA CAATTAGTTA ATAAACCCAA 
0181 CCACAACAAA ATGGCTGTCA AGGAGCAGAG GAGCCACCAC AAGAAGAGCC ACCACCATCG 
0241 CAGCCACCAG CCAAAGCAGG CCAGTGCATC CACAGAATCT CATCAATCCT CGTCGATTGA 
0301 ATCAATCTTC GTGGAGGAGC CGACGCTGGT GCTCGACCGC GAGGTGGCCT CCATCAACGT 
0361 GCCCGCCAAC G-CCAAGGCC ATCATCGCCG AGCAGGGCCC GTCCACCTAC AGCAA-GGAG 
0421 GCGCTCATCA AGGACAAGCT GAAGCCAGAC CCCTCCAC-T CTAGTCGAGA TCGAG-AAGA 
0481 GCCTGCTCTC GCTGTTCAAC ATGAA 
 Assemble Data

9885R-1.IR_full       1   TTTAATCCATTCAGCGAGCCCGCCTCGTTCAGTGATAGTGATAAAAGCCATCGGAGTAAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9885R-1.in silico     1   TTTAATCCATTCAGCGAGCCCGCCTCGTTCAGTGATAGTGATAAAAGCCATCGGAGTAAA 60


9885R-1.IR_full       61  ACAAACAAAAAACCTAGCAAAAGTGACGCGAACCGACAAGTTCAACGAAGTGCATAAGCC 120
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
9885R-1.in silico     61  ACAAACAAAAAACCTAGCAAAAGTGACGCGAACCGAC-AGTTCAACGAAGTGCATAAGCC 120


9885R-1.IR_full       121 AAGAACAGACCAATTAGAAAATTCCAAAAATAAGTCTAAACAATTAGTTAATAAACCCAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9885R-1.in silico     121 AAGAACAGACCAATTAGAAAATTCCAAAAATAAGTCTAAACAATTAGTTAATAAACCCAA 180


9885R-1.IR_full       181 CCACAACAAAATGGCTGTCAAGGAGCAGAGGAGCCACCACAAGAAGAGCCACCACCATCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9885R-1.in silico     181 CCACAACAAAATGGCTGTCAAGGAGCAGAGGAGCCACCACAAGAAGAGCCACCACCATCG 240


9885R-1.IR_full       241 CAGCCACCAGCCAAAGCAGGCCAGTGCATCCACAGAATCTCATCAATCCTCGTCGATTGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9885R-1.in silico     241 CAGCCACCAGCCAAAGCAGGCCAGTGCATCCACAGAATCTCATCAATCCTCGTCGATTGA 300


9885R-1.IR_full       301 ATCAATCTTCGTGGAGGAGCCGACGCTGGTGCTCGACCGCGAGGTGGCCTCCATCAACGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9885R-1.in silico     301 ATCAATCTTCGTGGAGGAGCCGACGCTGGTGCTCGACCGCGAGGTGGCCTCCATCAACGT 360


9885R-1.IR_full       361 GCCCGCCAACGCCCAAGGCCATCATCGCCGAGCAGGGCCCGTCCACCTACAGCAAGGGAG 420
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||
9885R-1.in silico     361 GCCCGCCAACG-CCAAGGCCATCATCGCCGAGCAGGGCCCGTCCACCTACAGCAA-GGAG 420


9885R-1.IR_full       421 GCGCTCATCAAGGACAAGCTGAAGCCAGACCCCTCCACTTCTAGTCGAGATCGAGNAAGA 480
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||
9885R-1.in silico     421 GCGCTCATCAAGGACAAGCTGAAGCCAGACCCCTCCAC-TCTAGTCGAGATCGAG-AAGA 480


9885R-1.IR_full       481 GCCTGNTCTCGCTGTTCAACATGAA 505
                          ||||| |||||||||||||||||||
9885R-1.in silico     481 GCCTGCTCTCGCTGTTCAACATGAA 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057963.4  CG9885-RA, transcript variant A (dpp), mRNA 
100   482  NM_164485.1  CG9885-RB, transcript variant B (dpp), mRNA 
100   482  NM_164486.1  CG9885-RC, transcript variant C (dpp), mRNA 
100   482  NM_164487.1  CG9885-RD, transcript variant D (dpp), mRNA 
100   482  NM_164488.1  CG9885-RE, transcript variant E (dpp), mRNA 
0.62   NM_165257.1  CG31790-RA (CG31790), mRNA 
0.2   NM_166341.1  CG30127-RA (CG30127), mRNA 
0   NM_137884.2  CG13532-RA (CG13532), mRNA 
0   NM_134729.2  CG4749-RA (CG4749), mRNA 
0   NM_141004.1  CG3680-RA (CG3680), mRNA 
0   NM_169500.1  CG8630-RA (CG8630), mRNA 
0   NM_168473.2  CG32088-RA (CG32088), mRNA 
0   NM_139541.1  CG12017-RA (CG12017), mRNA 
0   NM_169874.1  CG4608-RA (bnl), mRNA 
0   NM_142641.1  CG5434-RA (Srp72), mRNA 
0   NM_001032062.1  CG9515-RA, transcript variant A (CG9515), mRNA 
0   NM_001032063.1  CG9510-RB, transcript variant B (CG9510), mRNA 
0   NM_135413.2  CG9510-RA, transcript variant A (CG9510), mRNA 
0   10  NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_166724.1  CG32005-RA (CG32005), mRNA 
0   NM_140931.1  CG7290-RA (CG7290), mRNA 
0   NM_142919.1  CG10365-RA, transcript variant A (CG10365), mRNA 
0   NM_143367.2  CG10011-RA (CG10011), mRNA 
0   NM_205952.1  CG4128-RD, transcript variant D (nAcRalpha-30D), mRNA 
0   NM_205953.1  CG4128-RE, transcript variant E (nAcRalpha-30D), mRNA 
0   NM_164874.2  CG4128-RA, transcript variant A (nAcRalpha-30D), mRNA 
0   NM_205951.1  CG4128-RB, transcript variant B (nAcRalpha-30D), mRNA 
0   NM_135472.4  CG4128-RC, transcript variant C (nAcRalpha-30D), mRNA 
0   NM_170556.1  CG11525-RC, transcript variant C (CycG), mRNA 
0   NM_137034.2  CG17064-RA (mars), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.