National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9867R-1 
 Symbol CG9867  Full Name CG9867 
 CG No CG9867  Old CG No CG9867 
 Synonyms CG9867 
 Accession No (Link to NCBI) NM_134834.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Sakaidani Y, Ichiyanagi N, Saito C, Nomura T, Ito M, Nishio Y, Nadano D, Matsuda T, Furukawa K, Okajima T.
O-linked-N-acetylglucosamine modification of mammalian Notch receptors by an atypical O-GlcNAc transferase Eogt1.
Biochem. Biophys. Res. Commun. (2012) 419(1) 14-9 [ PubMed ID = 22310717 ] [ RRC reference ]

Sakaidani Y, Nomura T, Matsuura A, Ito M, Suzuki E, Murakami K, Nadano D, Matsuda T, Furukawa K, Okajima T.
O-linked-N-acetylglucosamine on extracellular protein domains mediates epithelial cell-matrix interactions.
Nat Commun (2011) 2 583 [ PubMed ID = 22158438 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCAAGCTGAAACAACAGCTGC 
 Primer Seq. 3'
aatctagaggtaccCAGAACGGGATGTGGTAAGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCAAGCTGAA ACAACAGCTG CCCACGAATC TCACCGGCAA GGGCACCATT TCATCCGCCT 
0061 GCTGGGGCTC ACGAGCGGGA CTGCACGCCA GCTGGCCGCT TCCAGACGCC CCAGTGCCCT 
0121 GGGGAACATA CCGGCTGGGC CAGGAGCAAG GAGGCACAGG TTAGGACCTT CTACAACCAG 
0181 GCCGACTTCG GGTACATCCA GGAGCAGCTC TCCCAACTGA CGCCGCAATG CGTGCCAACC 
0241 TATTTGGGCG ATTCCTCGCT AGAGTGCACG CACTACCTGC GCTTTTGTCG TGGGCGGAAT 
0301 CTTCTCTTCG ACTTTCGGGG CTTGGAGCAG CGGGAAGAGC GCATTCGTTA CCATATGGAT 
0361 GTGCTGGGAC CAGGACAGCT GCTGGGGCAC TGCAAGTTGA ATCGGTCTCG ACTTTCGGGC 
0421 GAAATGGAGC ACATTGGATC GGCTCTGCAG TCCTGGGGTC CGGAGTTGCG TAATTTTGAT 
0481 GTCTTACCAC ATCCCGTTCT G 
 in silico PCR Fragment
0001 CCAAGCTGAA ACAACAGCTG CCCACGAATC TCACCGGCAA GGGCACCATT TCATCCGCCT 
0061 GCTGGGGC-C ACGAGCGGGA CTGCACGCCA GCTGGCCGCT TCCAGACGCC CCAGTGCCCT 
0121 GGGGAACATA CCGGCTGGGC CAGGAGCAAG GAGGCACAGG TTAGGACCTT CTACAACCAG 
0181 GCCGACTTCG GGTACATCCA GGAGCAGCTC TCCCAACTGA CGCCGCAATG CGTGCCAACC 
0241 TATTTGGGCG ATTCCTCGCT AGAGTGCACG CACTACCTGC GCTTTTGTCG TGGGCGGAAT 
0301 CTTCTCTTCG ACTTTCGGGG CTTGGAGCAG CGGGAAGAGC GCATTCGTTA CCATATGGAT 
0361 GTGCTGGGAC CAGGACAGCT GCTGGGGCAC TGCAAGTTGA ATCGGACTCG ACTGTCGGGC 
0421 GAAATGGAGC ACATTGGATC GGCTCTGCAG TCCTGGGGTC CGGAGTTGCG TAATTTTGAT 
0481 GTCTTACCAC ATCCCGTTCT G 
 Assemble Data

9867R-1.IR_full       1   CCAAGCTGAAACAACAGCTGCCCACGAATCTCACCGGCAAGGGCACCATTTCATCCGCCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9867R-1.in silico     1   CCAAGCTGAAACAACAGCTGCCCACGAATCTCACCGGCAAGGGCACCATTTCATCCGCCT 60


9867R-1.IR_full       61  GCTGGGGCTCACGAGCGGGACTGCACGCCAGCTGGCCGCTTCCAGACGCCCCAGTGCCCT 120
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
9867R-1.in silico     61  GCTGGGGC-CACGAGCGGGACTGCACGCCAGCTGGCCGCTTCCAGACGCCCCAGTGCCCT 120


9867R-1.IR_full       121 GGGGAACATACCGGCTGGGCCAGGAGCAAGGAGGCACAGGTTAGGACCTTCTACAACCAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9867R-1.in silico     121 GGGGAACATACCGGCTGGGCCAGGAGCAAGGAGGCACAGGTTAGGACCTTCTACAACCAG 180


9867R-1.IR_full       181 GCCGACTTCGGGTACATCCAGGAGCAGCTCTCCCAACTGACGCCGCAATGCGTGCCAACC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9867R-1.in silico     181 GCCGACTTCGGGTACATCCAGGAGCAGCTCTCCCAACTGACGCCGCAATGCGTGCCAACC 240


9867R-1.IR_full       241 TATTTGGGCGATTCCTCGCTAGAGTGCACGCACTACCTGCGCTTTTGTCGTGGGCGGAAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9867R-1.in silico     241 TATTTGGGCGATTCCTCGCTAGAGTGCACGCACTACCTGCGCTTTTGTCGTGGGCGGAAT 300


9867R-1.IR_full       301 CTTCTCTTCGACTTTCGGGGCTTGGAGCAGCGGGAAGAGCGCATTCGTTACCATATGGAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9867R-1.in silico     301 CTTCTCTTCGACTTTCGGGGCTTGGAGCAGCGGGAAGAGCGCATTCGTTACCATATGGAT 360


9867R-1.IR_full       361 GTGCTGGGACCAGGACAGCTGCTGGGGCACTGCAAGTTGAATCGGTCTCGACTTTCGGGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||
9867R-1.in silico     361 GTGCTGGGACCAGGACAGCTGCTGGGGCACTGCAAGTTGAATCGGACTCGACTGTCGGGC 420


9867R-1.IR_full       421 GAAATGGAGCACATTGGATCGGCTCTGCAGTCCTGGGGTCCGGAGTTGCGTAATTTTGAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9867R-1.in silico     421 GAAATGGAGCACATTGGATCGGCTCTGCAGTCCTGGGGTCCGGAGTTGCGTAATTTTGAT 480


9867R-1.IR_full       481 GTCTTACCACATCCCGTTCTG 501
                          |||||||||||||||||||||
9867R-1.in silico     481 GTCTTACCACATCCCGTTCTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134834.2  CG9867-RA (CG9867), mRNA 
0.2   NM_164521.1  CG3542-RB, transcript variant B (CG3542), mRNA 
0.2   NM_134894.2  CG3542-RA, transcript variant A (CG3542), mRNA 
0   NM_168778.1  CG3979-RB, transcript variant B (Indy), mRNA 
0   NM_079426.2  CG3979-RA, transcript variant A (Indy), mRNA 
0   NM_168779.1  CG3979-RC, transcript variant C (Indy), mRNA 
0   NM_165238.2  CG31741-RA (CG31741), mRNA 
0   NM_135101.1  CG18266-RA (CG18266), mRNA 
0   NM_167834.1  CG17090-RB, transcript variant B (CG17090), mRNA 
0   NM_138194.2  CG17090-RA, transcript variant A (CG17090), mRNA 
0   NM_001015244.1  CG40460-PD.3 (CG40460), mRNA 
0   NM_001015252.1  CG40460-PG.3 (CG40460), mRNA 
0   NM_078694.2  CG17058-RA, transcript variant A (Peritrophin-A), mRNA 
0   NM_167694.1  CG17058-RB, transcript variant B (Peritrophin-A), mRNA 
0   NM_132268.1  CG12772-RA (CG12772), mRNA 
0   NM_078861.2  CG17332-RA, transcript variant A (VhaSFD), mRNA 
0   NM_165178.1  CG17332-RD, transcript variant D (VhaSFD), mRNA 
0   NM_165177.1  CG17332-RB, transcript variant B (VhaSFD), mRNA 
0   NM_176727.1  CG33174-RD, transcript variant D (CG33174), mRNA 
0   NM_078592.2  CG11172-RA (NFAT), mRNA 
0   NM_078859.2  CG5813-RA, transcript variant A (chif), mRNA 
0   NM_165156.1  CG5813-RB, transcript variant B (chif), mRNA 
0   NM_164393.1  CG4276-RA, transcript variant A (aru), mRNA 
0   NM_164395.1  CG4276-RC, transcript variant C (aru), mRNA 
0   NM_078725.2  CG4276-RD, transcript variant D (aru), mRNA 
0   NM_135338.1  CG8673-RA (CG8673), mRNA 
0   NM_132940.1  CG13005-RA (CG13005), mRNA 
0   NM_057346.3  CG3258-RA (ase), mRNA 
0   NM_167445.2  CG6294-RA (CG6294), mRNA 
0   NM_176733.2  CG6299-RB, transcript variant B (CG6299), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.