National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9862R-3 
 Symbol Rae1  Full Name Rae1 
 CG No CG9862  Old CG No CG9862 
 Synonyms CG9862, dmrae1, Rae1 
 Accession No (Link to NCBI) NM_137753.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jahanshahi M, Hsiao K, Jenny A, Pfleger CM.
The Hippo Pathway Targets Rae1 to Regulate Mitosis and Organ Size and to Feed Back to Regulate Upstream Components Merlin, Hippo, and Warts.
PLoS Genet. (2016) 12(8) e1006198 [ PubMed ID = 27494403 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGCTGGACGTTTGCTGGTCG 
 Primer Seq. 3'
aatctagaggtaccCTTTTGGATTCCCCGGATTCA 
 Predicted Fragment Size
490 
 IR fragment full Seq
0001 GTGCTGGACG TTTGCTGGTC GGACGACGGC AGCAAAGTGT TCGTCTGCCT CCTGCGACAA 
0061 GCAGGTGAAG CTCTGGGACC TCGCCTCCGA TCAAGTGATG CAAGTGGCGG CCCACGACGG 
0121 TCCCGTTAAG ACGTGCCACA TGGTCAAGGG ACCCACGTAC ACCTGCCTCA TGACCGGCTC 
0181 CTGGGACAAG ACCCTAAAGT TCTGGGACAC CCGTTCGCCC AATCCCATGA TGACCATCAA 
0241 TCTACCCGAG CGTTGCTACT GCGCCGATGT GGAGTATACC GATGGCCGTG GTGGGCACGG 
0301 CCAACAGAGG ACTCATCATA TACTCGCTGC AGAATAGCCC AACCGAGTAC AAGCGGCAGG 
0361 AGAGTCCGCT GAAGTACCAG CACCGTGCCA TTTCCATTTT CCGGGACAAG AAAAAAGAGC 
0421 CCACAgGCTG TGCGCTGGGC AGCATTGAGG GCCGTGTGGC CATTCAGTAT GTGAATCCGG 
0481 GGAATCCAAA AG 
 in silico PCR Fragment
0001 GTGCTGGACG TTTGCTGGTC GGACGACGGC AGCAAAGTGT TCGTC-GCCT CCTGCGACAA 
0061 GCAGGTGAAG CTCTGGGACC TCGCCTCCGA TCAAGTGATG CAAGTGGCGG CCCACGACGG 
0121 TCCCGTTAAG ACGTGCCACA TGGTCAAGGG ACCCACGTAC ACCTGCCTCA TGACCGGCTC 
0181 CTGGGACAAG ACCCTAAAGT TCTGGGACAC CCGTTCGCCC AATCCCATGA TGACCATCAA 
0241 TCTACCCGAG CGGTGCTACT GCGCCGATGT GGAGTAT-CC GATGGCCGTG GTGGGCACGG 
0301 CCAACAGAGG ACTCATCATA TACTCGCTGC AGAATAGCCC AACCGAGTAC AAGCGGCAGG 
0361 AGAGTCCGCT GAAGTACCAG CACCGTGCCA TTTCCATTTT CCGGGACAAG AAAAAAGAGC 
0421 CCACAGGCTG TGCGCTGGGC AGCATTGAGG GCCGTGTGGC CATTCAGTAT GTGAATCCGG 
0481 GGAATCCAAA AG 
 Assemble Data

9862R-3.IR_full       1   GTGCTGGACGTTTGCTGGTCGGACGACGGCAGCAAAGTGTTCGTCTGCCTCCTGCGACAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
9862R-3.in silico     1   GTGCTGGACGTTTGCTGGTCGGACGACGGCAGCAAAGTGTTCGTC-GCCTCCTGCGACAA 60


9862R-3.IR_full       61  GCAGGTGAAGCTCTGGGACCTCGCCTCCGATCAAGTGATGCAAGTGGCGGCCCACGACGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9862R-3.in silico     61  GCAGGTGAAGCTCTGGGACCTCGCCTCCGATCAAGTGATGCAAGTGGCGGCCCACGACGG 120


9862R-3.IR_full       121 TCCCGTTAAGACGTGCCACATGGTCAAGGGACCCACGTACACCTGCCTCATGACCGGCTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9862R-3.in silico     121 TCCCGTTAAGACGTGCCACATGGTCAAGGGACCCACGTACACCTGCCTCATGACCGGCTC 180


9862R-3.IR_full       181 CTGGGACAAGACCCTAAAGTTCTGGGACACCCGTTCGCCCAATCCCATGATGACCATCAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9862R-3.in silico     181 CTGGGACAAGACCCTAAAGTTCTGGGACACCCGTTCGCCCAATCCCATGATGACCATCAA 240


9862R-3.IR_full       241 TCTACCCGAGCGTTGCTACTGCGCCGATGTGGAGTATACCGATGGCCGTGGTGGGCACGG 300
                          |||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||
9862R-3.in silico     241 TCTACCCGAGCGGTGCTACTGCGCCGATGTGGAGTAT-CCGATGGCCGTGGTGGGCACGG 300


9862R-3.IR_full       301 CCAACAGAGGACTCATCATATACTCGCTGCAGAATAGCCCAACCGAGTACAAGCGGCAGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9862R-3.in silico     301 CCAACAGAGGACTCATCATATACTCGCTGCAGAATAGCCCAACCGAGTACAAGCGGCAGG 360


9862R-3.IR_full       361 AGAGTCCGCTGAAGTACCAGCACCGTGCCATTTCCATTTTCCGGGACAAGAAAAAAGAGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9862R-3.in silico     361 AGAGTCCGCTGAAGTACCAGCACCGTGCCATTTCCATTTTCCGGGACAAGAAAAAAGAGC 420


9862R-3.IR_full       421 CCACAGGCTGTGCGCTGGGCAGCATTGAGGGCCGTGTGGCCATTCAGTATGTGAATCCGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9862R-3.in silico     421 CCACAGGCTGTGCGCTGGGCAGCATTGAGGGCCGTGTGGCCATTCAGTATGTGAATCCGG 480


9862R-3.IR_full       481 GGAATCCAAAAG 492
                          ||||||||||||
9862R-3.in silico     481 GGAATCCAAAAG 492

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   472  NM_137753.2  CG9862-RA (Rae1), mRNA 
0   NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
0   NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
0   NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 
0   NM_079593.3  CG17228-RC, transcript variant C (pros), mRNA 
0   NM_138175.2  CG7020-RA (DIP2), mRNA 
0   NM_142453.3  CG7125-RA, transcript variant A (PKD), mRNA 
0   NM_169803.3  CG7125-RB, transcript variant B (PKD), mRNA 
0   NM_169804.3  CG7125-RC, transcript variant C (PKD), mRNA 
0   NM_169805.3  CG7125-RD, transcript variant D (PKD), mRNA 
0   NM_133075.2  CG6461-RA (CG6461), mRNA 
0   NM_144047.1  CG18679-RA (CG18679), mRNA 
0   NM_139808.1  CG10064-RA (CG10064), mRNA 
0   NM_080041.2  CG7935-RA (msk), mRNA 
0   NM_206365.1  CG11551-RA (ind), mRNA 
0   NM_167287.1  CG11715-RB, transcript variant B (Cyp4g15), mRNA 
0   NM_132493.2  CG11715-RA, transcript variant A (Cyp4g15), mRNA 
0   15  NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   15  NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_142487.1  CG7709-RA (CG7709), mRNA 
0   NM_137294.1  CG8317-RA (CG8317), mRNA 
0   NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   NM_206775.1  CG12348-RG, transcript variant G (Sh), mRNA 
0   NM_167592.2  CG12348-RD, transcript variant D (Sh), mRNA 
0   NM_078669.3  CG12348-RB, transcript variant B (Sh), mRNA 
0   NM_169256.1  CG11988-RC, transcript variant C (neur), mRNA 
0   NM_169255.1  CG11988-RD, transcript variant D (neur), mRNA 
0   NM_057304.3  CG11988-RA, transcript variant A (neur), mRNA 
0   NM_169257.1  CG11988-RB, transcript variant B (neur), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.