National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9862R-2 
 Symbol Rae1  Full Name Rae1 
 CG No CG9862  Old CG No CG9862 
 Synonyms CG9862, dmrae1, Rae1 
 Accession No (Link to NCBI) NM_137753.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Jahanshahi M, Hsiao K, Jenny A, Pfleger CM.
The Hippo Pathway Targets Rae1 to Regulate Mitosis and Organ Size and to Feed Back to Regulate Upstream Components Merlin, Hippo, and Warts.
PLoS Genet. (2016) 12(8) e1006198 [ PubMed ID = 27494403 ] [ RRC reference ]

Hayashi D, Tanabe K, Katsube H, Inoue YH.
B-type nuclear lamin and the nuclear pore complex Nup107-160 influences maintenance of the spindle envelope required for cytokinesis in Drosophila male meiosis.
Biol Open (2016) 5(8) 1011-21 [ PubMed ID = 27402967 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     1   GTGCTGGACGTTTGCTGGTCGGACGACGGCAGCAAAGTGTTCGTC-GCCTCCTGCGACAA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCAGGTGAAGCTCTGGGACCTCGCCTCCGATCAAGTGATGCAAGTGGCGGCCCACGACGG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCCCGTTAAGACGTGCCACATGGTCAAGGGACCCACGTACACCTGCCTCATGACCGGCTC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTGGGACAAGACCCTAAAGTTCTGGGACACCCGTTCGCCCAATCCCATGATGACCATCAA 240

                          |||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| silico     241 TCTACCCGAGCGGTGCTACTGCGCCGATGTGGAGTAT-CCGATGGCCGTGGTGGGCACGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCAACAGAGGACTCATCATATACTCGCTGCAGAATAGCCCAACCGAGTACAAGCGGCAGG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGAGTCCGCTGAAGTACCAGCACCGTGCCATTTCCATTTTCCGGGACAAGAAAAAAGAGC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCACAGGCTGTGCGCTGGGCAGCATTGAGGGCCGTGTGGCCATTCAGTATGTGAATCCGG 480

9862R-2.IR_full       481 GGAATCCAAAAG 492
                          |||||||||||| silico     481 GGAATCCAAAAG 492

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   472  NM_137753.2  CG9862-RA (Rae1), mRNA 
0   NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
0   NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
0   NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 
0   NM_079593.3  CG17228-RC, transcript variant C (pros), mRNA 
0   NM_138175.2  CG7020-RA (DIP2), mRNA 
0   NM_142453.3  CG7125-RA, transcript variant A (PKD), mRNA 
0   NM_169803.3  CG7125-RB, transcript variant B (PKD), mRNA 
0   NM_169804.3  CG7125-RC, transcript variant C (PKD), mRNA 
0   NM_169805.3  CG7125-RD, transcript variant D (PKD), mRNA 
0   NM_133075.2  CG6461-RA (CG6461), mRNA 
0   NM_144047.1  CG18679-RA (CG18679), mRNA 
0   NM_139808.1  CG10064-RA (CG10064), mRNA 
0   NM_080041.2  CG7935-RA (msk), mRNA 
0   NM_206365.1  CG11551-RA (ind), mRNA 
0   NM_167287.1  CG11715-RB, transcript variant B (Cyp4g15), mRNA 
0   NM_132493.2  CG11715-RA, transcript variant A (Cyp4g15), mRNA 
0   15  NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   15  NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_142487.1  CG7709-RA (CG7709), mRNA 
0   NM_137294.1  CG8317-RA (CG8317), mRNA 
0   NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   NM_206775.1  CG12348-RG, transcript variant G (Sh), mRNA 
0   NM_167592.2  CG12348-RD, transcript variant D (Sh), mRNA 
0   NM_078669.3  CG12348-RB, transcript variant B (Sh), mRNA 
0   NM_169256.1  CG11988-RC, transcript variant C (neur), mRNA 
0   NM_169255.1  CG11988-RD, transcript variant D (neur), mRNA 
0   NM_057304.3  CG11988-RA, transcript variant A (neur), mRNA 
0   NM_169257.1  CG11988-RB, transcript variant B (neur), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.