National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9791R-2 
 Symbol CG9791  Full Name CG9791 
 CG No CG9791  Old CG No CG9791 
 Synonyms CG9791 
 Accession No (Link to NCBI) NM_141195.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Clemente P, Pajak A, Laine I, Wibom R, Wedell A, Freyer C, Wredenberg A.
SUV3 helicase is required for correct processing of mitochondrial transcripts.
Nucleic Acids Res. (2015) 43(15) 7398-413 [ PubMed ID = 26152302 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTGCGTCCGTCCTTTTCAAT 
 Primer Seq. 3'
aatctagaggtaccTGATGGCGCGAGCGTTGCTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTGCGTCCG TCCTTTTCAA TTGATTTGTC CCTGCGCCGA CTGCATCGTG CGGCCTTTTT 
0061 ATTTTCTCGA AAAAAACCGG AGACGAACTT GTCCACGTTG TTCAAGCCAG TACAGGTGCA 
0121 CGCTTATGTG GATTCAGAGG ACGTAGGTTC CGAGCTGTCG GGCAAACTGG AAAAGGCTGA 
0181 GCTGCTGAAG ATTCTTAATA AGTTCACCCA ACGTCGCGAA ATCAAGTCAC TATGCAACGA 
0241 AAACGGACTG GACGACTACC TACAGCAANC AAGCCTTTGG CTCATTCCGA AGATTTTGCA 
0301 TCGAGGCAGA AAACCTTCCA GTAGATCTGC ACATAACCTT TAGCGATATA ACACAGGGAG 
0361 CGGGTCATAT CGATGACATC TTCCCGTACT TCCTACGACA CGCAAAGACA GTATTCCCGC 
0421 ACCTGGACTG CATGGACGAC CTGAAAAAGA TTTCCGACCT GAGGCAGCCT GCCAACTGGT 
0481 ATAGCAACgC TCGCGCCATC A 
 in silico PCR Fragment
0001 CCTGCGTCCG TCCTTTTCAA TTGATTTGTC CCTGCGCCGA CTGCATCGTG CGGCCTTTTT 
0061 ATTTTCTCGA AAAAAACCGG AGACGAACTT GTCCACGTTG TTCAAGCCAG TACAGGTGCA 
0121 CGCTTATGTG GATTCAGAGG ACGTAGGTTC CGAGCTGTCG GGCAAACTGG AAAAGGCTGA 
0181 GCTGCTGAAG ATTCTTAATA AGTTCACCCA ACGTCGCGAA ATCAAGTCAC TATGCAACGA 
0241 AAACGGACTG GACGACTACC TACAGCAA-C AGGCCTTTGG CTCATTCCGA AGATTTTGCA 
0301 TCGAGGCAGA AAACCTTCCA GTAGATCTGC ACATAACCTT TAGCGATATA ACACAGGGAG 
0361 CGGGTCATAT CGATGACATC TTCCCGTACT TCCTACGACA CGCAAAGACA GTATTCCCGC 
0421 ACCTGGACTG CATGGACGAC CTGAAAAAGA TTTCCGACCT GAGGCAGCCT GCCAACTGGT 
0481 ATAGCAACGC TCGCGCCATC A 
 Assemble Data

9791R-2.IR_full       1   CCTGCGTCCGTCCTTTTCAATTGATTTGTCCCTGCGCCGACTGCATCGTGCGGCCTTTTT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9791R-2.in silico     1   CCTGCGTCCGTCCTTTTCAATTGATTTGTCCCTGCGCCGACTGCATCGTGCGGCCTTTTT 60


9791R-2.IR_full       61  ATTTTCTCGAAAAAAACCGGAGACGAACTTGTCCACGTTGTTCAAGCCAGTACAGGTGCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9791R-2.in silico     61  ATTTTCTCGAAAAAAACCGGAGACGAACTTGTCCACGTTGTTCAAGCCAGTACAGGTGCA 120


9791R-2.IR_full       121 CGCTTATGTGGATTCAGAGGACGTAGGTTCCGAGCTGTCGGGCAAACTGGAAAAGGCTGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9791R-2.in silico     121 CGCTTATGTGGATTCAGAGGACGTAGGTTCCGAGCTGTCGGGCAAACTGGAAAAGGCTGA 180


9791R-2.IR_full       181 GCTGCTGAAGATTCTTAATAAGTTCACCCAACGTCGCGAAATCAAGTCACTATGCAACGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9791R-2.in silico     181 GCTGCTGAAGATTCTTAATAAGTTCACCCAACGTCGCGAAATCAAGTCACTATGCAACGA 240


9791R-2.IR_full       241 AAACGGACTGGACGACTACCTACAGCAANCAAGCCTTTGGCTCATTCCGAAGATTTTGCA 300
                          |||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||
9791R-2.in silico     241 AAACGGACTGGACGACTACCTACAGCAA-CAGGCCTTTGGCTCATTCCGAAGATTTTGCA 300


9791R-2.IR_full       301 TCGAGGCAGAAAACCTTCCAGTAGATCTGCACATAACCTTTAGCGATATAACACAGGGAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9791R-2.in silico     301 TCGAGGCAGAAAACCTTCCAGTAGATCTGCACATAACCTTTAGCGATATAACACAGGGAG 360


9791R-2.IR_full       361 CGGGTCATATCGATGACATCTTCCCGTACTTCCTACGACACGCAAAGACAGTATTCCCGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9791R-2.in silico     361 CGGGTCATATCGATGACATCTTCCCGTACTTCCTACGACACGCAAAGACAGTATTCCCGC 420


9791R-2.IR_full       421 ACCTGGACTGCATGGACGACCTGAAAAAGATTTCCGACCTGAGGCAGCCTGCCAACTGGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9791R-2.in silico     421 ACCTGGACTGCATGGACGACCTGAAAAAGATTTCCGACCTGAGGCAGCCTGCCAACTGGT 480


9791R-2.IR_full       481 ATAGCAACGCTCGCGCCATCA 501
                          |||||||||||||||||||||
9791R-2.in silico     481 ATAGCAACGCTCGCGCCATCA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141195.2  CG9791-RA, transcript variant A (CG9791), mRNA 
100   482  NM_164336.1  CG9791-RB, transcript variant B (CG9791), mRNA 
0.2   NM_079456.2  CG6625-RA (Snap), mRNA 
0   NM_206051.1  CG2105-RB, transcript variant B (Corin), mRNA 
0   NM_136453.1  CG2105-RA, transcript variant A (Corin), mRNA 
0   NM_205938.1  CG13401-RB, transcript variant B (U26), mRNA 
0   NM_135386.3  CG13401-RA, transcript variant A (U26), mRNA 
0   NM_136344.1  CG14470-RA (CG14470), mRNA 
0   NM_079741.2  CG10210-RA (tst), mRNA 
0   NM_078903.3  CG12110-RD, transcript variant D (Pld), mRNA 
0   NM_165472.2  CG12110-RE, transcript variant E (Pld), mRNA 
0   NM_165469.2  CG12110-RA, transcript variant A (Pld), mRNA 
0   NM_165471.2  CG12110-RC, transcript variant C (Pld), mRNA 
0   NM_165470.2  CG12110-RB, transcript variant B (Pld), mRNA 
0   NM_142072.2  CG9922-RA (CG9922), mRNA 
0   NM_165697.1  CG30001-RA (CG30001), mRNA 
0   NR_001369.1  CG30001-RA (CG30001), mRNA, mRNA 
0   NM_137884.2  CG13532-RA (CG13532), mRNA 
0   NM_164797.1  CG8475-RB, transcript variant B (CG8475), mRNA 
0   NM_135345.2  CG8475-RA, transcript variant A (CG8475), mRNA 
0   NM_079069.2  CG10023-RA, transcript variant A (Fak56D), mRNA 
0   NM_166352.1  CG10023-RB, transcript variant B (Fak56D), mRNA 
0   NM_166353.1  CG10023-RC, transcript variant C (Fak56D), mRNA 
0   NM_164507.2  CG2986-RB, transcript variant B (oho23B), mRNA 
0   NM_078738.4  CG2986-RC, transcript variant C (oho23B), mRNA 
0   NM_164506.2  CG2986-RA, transcript variant A (oho23B), mRNA 
0   NM_164508.2  CG2986-RD, transcript variant D (oho23B), mRNA 
0   NM_130543.3  CG32812-RA (CG32812), mRNA 
0   NM_136067.2  CG17322-RD, transcript variant D (CG17322), mRNA 
0   NM_136160.1  CG13962-RA (CG13962), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.