National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9774R-3 
 Symbol rok  Full Name Rho-kinase 
 CG No CG9774  Old CG No CG9774 
 Synonyms ROCK, Drok, Rok, DROK, ROK, ROKalpha/beta, drok, Rock, RhoK, dROK, dRok, DRhk, ROCK1, CG9774, unnamed, Rhk, rok 
 Accession No (Link to NCBI) NM_080535.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kotoula V, Moressis A, Semelidou O, Skoulakis EMC.
Drk-mediated signaling to Rho kinase is required for anesthesia-resistant memory in Drosophila.
Proc. Natl. Acad. Sci. U.S.A. (2017) 114(41) 10984-10989 [ PubMed ID = 28973902 ] [ RRC reference ]

Yashiro H, Loza AJ, Skeath JB, Longmore GD.
Rho1 regulates adherens junction remodeling by promoting recycling endosome formation through activation of myosin II.
Mol. Biol. Cell (2014) 25(19) 2956-69 [ PubMed ID = 25079692 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAACTGTGACCAAGCAGCGCA 
 Primer Seq. 3'
aatctagaggtaccTATATCGCCGCCGGGCATAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAACTGTGAC CAAGCAGCGC AGCATGGATG TGGAACGAAG GCGCCGGGCG AATACGCTCG 
0061 AGcGCGAGAT GCGCGATCCG ACCAGCATCT GCAATGTGGA CTGCCTGCTG GACACGGTGT 
0121 CGGCCTTGGT CAGCGATTGT GACCACGAGT CCCTGAGGCG GCTTAAGAAC ATCGAGCAGT 
0181 ATGCGGCCAA ATACAAACCA TTGGCAATGC AGATCAATCA GCTGCGCATG AACGTCGAGG 
0241 ATTTCCATTT TATCAAACTC ATCGGCGCCG GCGCCTTTGG AGAGGTGCAG CTGGTGCGGC 
0301 ACAAGTCCTC CAGCCAGGTG TACGCCATGA AGCGGCTGTC CAAATTCGAG ATGATGAAGC 
0361 GACCGGACTC CGCGTTCTTC TGGGAGGAGC GACACATTAT GGCGCACGCC AACTCCGAAT 
0421 GGATCGTTCA GCTGCACTTT GCATTTCAGG ATGCCAAATA CCTATACATG GTGATGGACT 
0481 TTATGCCCGG CGGCGATATA  
 in silico PCR Fragment
0001 AAACTGTGAC CAAGCAGCGC AGCATGGATG TGGAACGAAG GCGCCGGGCG AATACGCTCG 
0061 AGCGCGAGAT GCGCGATCCG ACCAGCATCT GCAATGTGGA CTGCCTGCTG GACACGGTGT 
0121 CGGCCTTGGT CAGCGATTGT GACCACGAGT CCCTGAGGCG GCTTAAGAAC ATCGAGCAGT 
0181 ATGCGGCCAA ATACAAACCA TTGGCAATGC AGATCAATCA GCTGCGCATG AACGTCGAGG 
0241 ATTTCCATTT TATCAAACTC ATCGGCGCCG GCGCCTTTGG AGAGGTGCAG CTGGTGCGGC 
0301 ACAAGTCCTC CAGCCAGGTG TACGCCATGA AGCGGCTGTC CAAATTCGAG ATGATGAAGC 
0361 GACCGGACTC CGCGTTCTTC TGGGAGGAGC GACACATTAT GGCGCACGCC AACTCCGAAT 
0421 GGATCGTTCA GCTGCACTTT GCATTTCAGG ATGCCAAATA CCTATACATG GTGATGGACT 
0481 TTATGCCCGG CGGCGATATA  
 Assemble Data

9774R-3.IR_full       1   AAACTGTGACCAAGCAGCGCAGCATGGATGTGGAACGAAGGCGCCGGGCGAATACGCTCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9774R-3.in silico     1   AAACTGTGACCAAGCAGCGCAGCATGGATGTGGAACGAAGGCGCCGGGCGAATACGCTCG 60


9774R-3.IR_full       61  AGCGCGAGATGCGCGATCCGACCAGCATCTGCAATGTGGACTGCCTGCTGGACACGGTGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9774R-3.in silico     61  AGCGCGAGATGCGCGATCCGACCAGCATCTGCAATGTGGACTGCCTGCTGGACACGGTGT 120


9774R-3.IR_full       121 CGGCCTTGGTCAGCGATTGTGACCACGAGTCCCTGAGGCGGCTTAAGAACATCGAGCAGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9774R-3.in silico     121 CGGCCTTGGTCAGCGATTGTGACCACGAGTCCCTGAGGCGGCTTAAGAACATCGAGCAGT 180


9774R-3.IR_full       181 ATGCGGCCAAATACAAACCATTGGCAATGCAGATCAATCAGCTGCGCATGAACGTCGAGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9774R-3.in silico     181 ATGCGGCCAAATACAAACCATTGGCAATGCAGATCAATCAGCTGCGCATGAACGTCGAGG 240


9774R-3.IR_full       241 ATTTCCATTTTATCAAACTCATCGGCGCCGGCGCCTTTGGAGAGGTGCAGCTGGTGCGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9774R-3.in silico     241 ATTTCCATTTTATCAAACTCATCGGCGCCGGCGCCTTTGGAGAGGTGCAGCTGGTGCGGC 300


9774R-3.IR_full       301 ACAAGTCCTCCAGCCAGGTGTACGCCATGAAGCGGCTGTCCAAATTCGAGATGATGAAGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9774R-3.in silico     301 ACAAGTCCTCCAGCCAGGTGTACGCCATGAAGCGGCTGTCCAAATTCGAGATGATGAAGC 360


9774R-3.IR_full       361 GACCGGACTCCGCGTTCTTCTGGGAGGAGCGACACATTATGGCGCACGCCAACTCCGAAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9774R-3.in silico     361 GACCGGACTCCGCGTTCTTCTGGGAGGAGCGACACATTATGGCGCACGCCAACTCCGAAT 420


9774R-3.IR_full       421 GGATCGTTCAGCTGCACTTTGCATTTCAGGATGCCAAATACCTATACATGGTGATGGACT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9774R-3.in silico     421 GGATCGTTCAGCTGCACTTTGCATTTCAGGATGCCAAATACCTATACATGGTGATGGACT 480


9774R-3.IR_full       481 TTATGCCCGGCGGCGATATA 500
                          ||||||||||||||||||||
9774R-3.in silico     481 TTATGCCCGGCGGCGATATA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080535.2  CG9774-RA (rok), mRNA 
0   NM_141738.3  CG6303-RA (Bruce), mRNA 
0   NM_143177.2  CG5878-RA (alpha4GT2), mRNA 
0   NM_132089.3  CG3847-RA (CG3847), mRNA 
0   NM_136702.2  CG18445-RA (CG18445), mRNA 
0   NM_143555.2  CG9717-RA (CG9717), mRNA 
0   NM_140174.4  CG7839-RA (CG7839), mRNA 
0   NM_166590.1  CG30412-RB, transcript variant B (CG30412), mRNA 
0   NM_137933.2  CG30412-RA, transcript variant A (CG30412), mRNA 
0   NM_001015396.1  CG40411-PC.3 (CG40411), mRNA 
0   NM_001015395.1  CG40411-PE.3 (CG40411), mRNA 
0   NM_001015397.1  CG40411-PD.3 (CG40411), mRNA 
0   NM_141674.2  CG9448-RA (CG9448), mRNA 
0   NM_141325.1  CG2091-RA (CG2091), mRNA 
0   NM_144455.2  CG18764-RA (CG18764), mRNA 
0   NM_143729.2  CG17342-RA, transcript variant A (Lk6), mRNA 
0   NM_169423.2  CG17342-RB, transcript variant B (Lk6), mRNA 
0   NM_139377.2  CG7955-RC, transcript variant C (CG7955), mRNA 
0   NM_167902.1  CG7955-RA, transcript variant A (CG7955), mRNA 
0   NM_167903.1  CG7955-RB, transcript variant B (CG7955), mRNA 
0   NM_137481.2  CG17524-RA (GstE3), mRNA 
0   NM_206233.1  CG33230-RA (CG33230), mRNA 
0   NM_001042896.1  CG16863-RB, transcript variant B (CG16863), mRNA 
0   NM_135830.3  CG16863-RA, transcript variant A (CG16863), mRNA 
0   NM_134774.2  CG17646-RA, transcript variant A (CG17646), mRNA 
0   NM_164436.1  CG17646-RB, transcript variant B (CG17646), mRNA 
0   NM_145193.1  CG30185-RA (CG30185), mRNA 
0   NM_135777.1  CG16813-RA (CG16813), mRNA 
0   NM_136167.1  CG13964-RA (CG13964), mRNA 
0   NM_079446.2  CG8637-RA (trc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.