National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9774R-2 
 Symbol rok  Full Name Rho-kinase 
 CG No CG9774  Old CG No CG9774 
 Synonyms ROCK, Drok, Rok, DROK, ROK, ROKalpha/beta, drok, Rock, RhoK, dROK, dRok, DRhk, ROCK1, CG9774, unnamed, Rhk, rok 
 Accession No (Link to NCBI) NM_080535.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Aranjuez G, Burtscher A, Sawant K, Majumder P, McDonald JA.
Dynamic myosin activation promotes collective morphology and migration by locally balancing oppositional forces from surrounding tissue.
Mol. Biol. Cell (2016) 27(12) 1898-910 [ PubMed ID = 27122602 ] [ RRC reference ]

Yashiro H, Loza AJ, Skeath JB, Longmore GD.
Rho1 regulates adherens junction remodeling by promoting recycling endosome formation through activation of myosin II.
Mol. Biol. Cell (2014) 25(19) 2956-69 [ PubMed ID = 25079692 ] [ RRC reference ]

Baek SH, Cho HW, Kwon YC, Lee JH, Kim MJ, Lee H, Choe KM.
Requirement for Pak3 in Rac1-induced organization of actin and myosin during Drosophila larval wound healing.
FEBS Lett. (2012) 586(6) 772-7 [ PubMed ID = 22449966 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AAACTGTGACCAAGCAGCGCAGCATGGATGTGGAACGAAGGCGCCGGGCGAATACGCTCG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGCGCGAGATGCGCGATCCGACCAGCATCTGCAATGTGGACTGCCTGCTGGACACGGTGT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGGCCTTGGTCAGCGATTGTGACCACGAGTCCCTGAGGCGGCTTAAGAACATCGAGCAGT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATGCGGCCAAATACAAACCATTGGCAATGCAGATCAATCAGCTGCGCATGAACGTCGAGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATTTCCATTTTATCAAACTCATCGGCGCCGGCGCCTTTGGAGAGGTGCAGCTGGTGCGGC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACAAGTCCTCCAGCCAGGTGTACGCCATGAAGCGGCTGTCCAAATTCGAGATGATGAAGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GACCGGACTCCGCGTTCTTCTGGGAGGAGCGACACATTATGGCGCACGCCAACTCCGAAT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGATCGTTCAGCTGCACTTTGCATTTCAGGATGCCAAATACCTATACATGGTGATGGACT 480

9774R-2.IR_full       481 TTATGCCCGGCGGCGATATA 500
                          |||||||||||||||||||| silico     481 TTATGCCCGGCGGCGATATA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080535.2  CG9774-RA (rok), mRNA 
0   NM_141738.3  CG6303-RA (Bruce), mRNA 
0   NM_143177.2  CG5878-RA (alpha4GT2), mRNA 
0   NM_132089.3  CG3847-RA (CG3847), mRNA 
0   NM_136702.2  CG18445-RA (CG18445), mRNA 
0   NM_143555.2  CG9717-RA (CG9717), mRNA 
0   NM_140174.4  CG7839-RA (CG7839), mRNA 
0   NM_166590.1  CG30412-RB, transcript variant B (CG30412), mRNA 
0   NM_137933.2  CG30412-RA, transcript variant A (CG30412), mRNA 
0   NM_001015396.1  CG40411-PC.3 (CG40411), mRNA 
0   NM_001015395.1  CG40411-PE.3 (CG40411), mRNA 
0   NM_001015397.1  CG40411-PD.3 (CG40411), mRNA 
0   NM_141674.2  CG9448-RA (CG9448), mRNA 
0   NM_141325.1  CG2091-RA (CG2091), mRNA 
0   NM_144455.2  CG18764-RA (CG18764), mRNA 
0   NM_143729.2  CG17342-RA, transcript variant A (Lk6), mRNA 
0   NM_169423.2  CG17342-RB, transcript variant B (Lk6), mRNA 
0   NM_139377.2  CG7955-RC, transcript variant C (CG7955), mRNA 
0   NM_167902.1  CG7955-RA, transcript variant A (CG7955), mRNA 
0   NM_167903.1  CG7955-RB, transcript variant B (CG7955), mRNA 
0   NM_137481.2  CG17524-RA (GstE3), mRNA 
0   NM_206233.1  CG33230-RA (CG33230), mRNA 
0   NM_001042896.1  CG16863-RB, transcript variant B (CG16863), mRNA 
0   NM_135830.3  CG16863-RA, transcript variant A (CG16863), mRNA 
0   NM_134774.2  CG17646-RA, transcript variant A (CG17646), mRNA 
0   NM_164436.1  CG17646-RB, transcript variant B (CG17646), mRNA 
0   NM_145193.1  CG30185-RA (CG30185), mRNA 
0   NM_135777.1  CG16813-RA (CG16813), mRNA 
0   NM_136167.1  CG13964-RA (CG13964), mRNA 
0   NM_079446.2  CG8637-RA (trc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.