National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9763R-2 
 Symbol pyd  Full Name polychaetoid 
 CG No CG31349  Old CG No CG9763 
 Synonyms ZO-1, CT36877, pyd(Z01), Tamou, Pyd/ZO-1, CG9763, ZO1, Pyd, tam, dzo-1, DZO-1, xvt, Pch, CG9729, CG12409, CG11962, CG11782, CG31349, pyd, polychaetoid, tamou, extra verticals 
 Accession No (Link to NCBI) NM_169245.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Carrasco-Rando M, Prieto-Sánchez S, Culi J, Tutor AS, Ruiz-Gómez M.
A specific isoform of Pyd/ZO-1 mediates junctional remodeling and formation of slit diaphragms.
J. Cell Biol. (2019) [ PubMed ID = 31171632 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAACATGTTGGTGGGTGATCG 
 Primer Seq. 3'
aatctagaggtaccTGGTGAGGGTCACCTTGATGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAACATGTTG GTGGGTGATC GAACCACATG GGAGTACCAC ACGGTGGCGG TGACTCGGGT 
0061 GCCGGGCTAT GGATTCGGCA TCGNCGTTTC CGGTGGACGT GATAATCCGC ACTTCGCCAA 
0121 CGGCGATCCC TCGATAGCAG TTAGCGATGT GCTGAAAGGT GGCCCCGCCG AGGNATCGAT 
0181 TGCAAGTCAA CGATCGGATA ATCTCGGTGA ACGGCGTCTC TCTGGAGAAC GTGGAATATG 
0241 CTACCGCGGT GCAGGTGTTA CGCGATAGTG GCAACACGGN TGCAATTGGT GGTCAAGCGT 
0301 CGCGTGCCCC TCAATCCCAT TAATGCTGCA GGTGCANGTG CAGCATCAGC ATTCACACAG 
0361 TCTCAGTTCG GTTGGTCTAA TGGCCAATGG AAGTGGAGGA GTGGCGCCAA CCCCCCTTAC 
0421 GAGTCTGAGT CAACCCAATT CGCTGAACTC TTCCCTAGTG CAGAATGCCA GCAGTGGTCA 
0481 GCCCATCAAG GTGACCCTCA CCA 
 in silico PCR Fragment
0001 CAACATGTTG GTGGGTGATC GAACCACATG GGAGTACCAC ACGGTGGCGG TGACTCGGGT 
0061 GCCGGGCTAT GGATTCGGCA TCGCCGTTTC CGGTGGACGT GATAATCCGC ACTTCGCCAA 
0121 CGGCGATCCC TCGATAGCAG TTAGCGATGT GCTGAAAGGT GGCCCCGCCG AGG-ATCGAT 
0181 TGCAAGTCAA CGATCGGATA ATCTCGGTGA ACGGCGTCTC TCTGGAGAAC GTGGAATATG 
0241 CTACCGCGGT GCAGGTGTTA CGCGATAGTG GCAACACGG- TGCAATTGGT GGTCAAGCGT 
0301 CGCGTGCCCC TCAATCCCAT TAATGCTGCA GGTGCA-GTG CAGCATCAGC ATTCACACAG 
0361 TCTCAGTTCG GTTGGTCTAA TGGCCAATGG AAGTGGAGGA GTGGCGCCAA CCCCCATTAC 
0421 GAGTCTGAGT CAACCCAACT CGCTGAACTC TTCCCTAGTG CAGAATGCCA GCAGTGGTCA 
0481 GCCCATCAAG GTGACCCTCA CCA 
 Assemble Data

9763R-2.IR_full       1   CAACATGTTGGTGGGTGATCGAACCACATGGGAGTACCACACGGTGGCGGTGACTCGGGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9763R-2.in silico     1   CAACATGTTGGTGGGTGATCGAACCACATGGGAGTACCACACGGTGGCGGTGACTCGGGT 60


9763R-2.IR_full       61  GCCGGGCTATGGATTCGGCATCGNCGTTTCCGGTGGACGTGATAATCCGCACTTCGCCAA 120
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
9763R-2.in silico     61  GCCGGGCTATGGATTCGGCATCGCCGTTTCCGGTGGACGTGATAATCCGCACTTCGCCAA 120


9763R-2.IR_full       121 CGGCGATCCCTCGATAGCAGTTAGCGATGTGCTGAAAGGTGGCCCCGCCGAGGNATCGAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
9763R-2.in silico     121 CGGCGATCCCTCGATAGCAGTTAGCGATGTGCTGAAAGGTGGCCCCGCCGAGG-ATCGAT 180


9763R-2.IR_full       181 TGCAAGTCAACGATCGGATAATCTCGGTGAACGGCGTCTCTCTGGAGAACGTGGAATATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9763R-2.in silico     181 TGCAAGTCAACGATCGGATAATCTCGGTGAACGGCGTCTCTCTGGAGAACGTGGAATATG 240


9763R-2.IR_full       241 CTACCGCGGTGCAGGTGTTACGCGATAGTGGCAACACGGNTGCAATTGGTGGTCAAGCGT 300
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
9763R-2.in silico     241 CTACCGCGGTGCAGGTGTTACGCGATAGTGGCAACACGG-TGCAATTGGTGGTCAAGCGT 300


9763R-2.IR_full       301 CGCGTGCCCCTCAATCCCATTAATGCTGCAGGTGCANGTGCAGCATCAGCATTCACACAG 360
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
9763R-2.in silico     301 CGCGTGCCCCTCAATCCCATTAATGCTGCAGGTGCA-GTGCAGCATCAGCATTCACACAG 360


9763R-2.IR_full       361 TCTCAGTTCGGTTGGTCTAATGGCCAATGGAAGTGGAGGAGTGGCGCCAACCCCCCTTAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
9763R-2.in silico     361 TCTCAGTTCGGTTGGTCTAATGGCCAATGGAAGTGGAGGAGTGGCGCCAACCCCCATTAC 420


9763R-2.IR_full       421 GAGTCTGAGTCAACCCAATTCGCTGAACTCTTCCCTAGTGCAGAATGCCAGCAGTGGTCA 480
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
9763R-2.in silico     421 GAGTCTGAGTCAACCCAACTCGCTGAACTCTTCCCTAGTGCAGAATGCCAGCAGTGGTCA 480


9763R-2.IR_full       481 GCCCATCAAGGTGACCCTCACCA 503
                          |||||||||||||||||||||||
9763R-2.in silico     481 GCCCATCAAGGTGACCCTCACCA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169246.2  CG31349-RC, transcript variant C (pyd), mRNA 
100   482  NM_169245.2  CG31349-RA, transcript variant A (pyd), mRNA 
100   482  NM_057349.4  CG31349-RB, transcript variant B (pyd), mRNA 
100   482  NM_176426.2  CG31349-RF, transcript variant F (pyd), mRNA 
97.3   469  NM_170646.3  CG31349-RE, transcript variant E (pyd), mRNA 
0   NM_143355.1  CG12852-RA (CG12852), mRNA 
0   NM_135534.1  CG4972-RA (CG4972), mRNA 
0   NM_164995.1  CG5353-RC, transcript variant C (Aats-thr), mRNA 
0   NM_164994.1  CG5353-RA, transcript variant A (Aats-thr), mRNA 
0   NM_080100.4  CG5353-RB, transcript variant B (Aats-thr), mRNA 
0   NM_142354.1  CG4090-RA (CG4090), mRNA 
0   NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0   NM_143342.1  CG5514-RB, transcript variant B (CG5514), mRNA 
0   NM_170361.1  CG5514-RA, transcript variant A (CG5514), mRNA 
0   NM_080712.5  CG1693-RA, transcript variant A (tty), mRNA 
0   NM_167744.3  CG1693-RB, transcript variant B (tty), mRNA 
0   NM_132328.1  CG17446-RA (CG17446), mRNA 
0   NM_176581.2  CG33204-RA (CG33204), mRNA 
0   NM_136039.2  CG10211-RA (CG10211), mRNA 
0   NM_142445.1  CG7146-RA (CG7146), mRNA 
0   NM_141029.1  CG12976-RA (CG12976), mRNA 
0   NM_170484.1  CG1469-RC, transcript variant C (Fer2LCH), mRNA 
0   NM_170483.1  CG1469-RB, transcript variant B (Fer2LCH), mRNA 
0   NM_080063.2  CG1469-RA, transcript variant A (Fer2LCH), mRNA 
0   NM_166066.1  CG30476-RA (ave), mRNA 
0   NM_139854.1  CG8583-RA (sec63), mRNA 
0   NM_165043.1  CG16954-RB, transcript variant B (Hsp60D), mRNA 
0   NM_135812.2  CG16954-RA, transcript variant A (Hsp60D), mRNA 
0   NM_132755.1  CG9509-RA (CG9509), mRNA 
0   NM_137249.1  CG18243-RA (Ptp52F), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.