National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9749R-3 
 Symbol Abi  Full Name Abelson Interacting Protein 
 CG No CG9749  Old CG No CG9749 
 Synonyms dAbi, Abi-1, CG9749, Ablphilin, Abi, Abelson Interacting Protein 
 Accession No (Link to NCBI) NM_057915.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Barlan K, Cetera M, Horne-Badovinac S.
Fat2 and Lar Define a Basally Localized Planar Signaling System Controlling Collective Cell Migration.
Dev. Cell (2017) 40(5) 467-477.e5 [ PubMed ID = 28292425 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGAGTCCCAGATGAACCAC 
 Primer Seq. 3'
aatctagaggtaccGAAGCCGTCGACATTCGCTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGAGTCCC AGATGAACCA CATCGCCCAG ACGGTGCATA TCCACAAGGA GAAGGTGGCC 
0061 AGGAGAGAGA TTGGCGTGCT TACGGCTAAC AAGGTGAGCT CGCGCCAGTT TAAGATCGTG 
0121 GCGCCCATCA ATCCGGAGAA GCCCATTCAA GTATGTGCGC AAGCCCATCG ACTACTCGAT 
0181 GTTGGACGAG ATTGGCCACG GCATTAACTC GGCCCAGCAC TcGCAGGTGC GACAGAAACA 
0241 TCgGGGCTCC AGCCATGGGT CCGTGCAATC CTTATTGCCG CCGTCGGTGG GACCTCCGCC 
0301 AACCACGAAG CCCCCAACTC CGCCGCAGAT GTCGCGAGCT GGGAACACTG GCACACTGGG 
0361 CAAGTCGGTC AGCAATACCG GGACACTGGG CAAGAGTTCG CGGGAGTACC GCACTCCGNC 
0421 TGTGGTCAAT CCACCACAgG TGCCATCGCA CTACGCTCCC AACTATCCTA TTGGGCATCC 
0481 AAAGCGAATG TCTGACGGCt TC 
 in silico PCR Fragment
0001 ATGGAGTCCC AGATGAACCA CATCGCCCAG ACGGTGCATA TCCACAAGGA GAAGGTGGCC 
0061 AGGAGAGAGA TTGGCGTGCT TACGGCTAAC AAGGTGAGCT CGCGCCAGTT TAAGATCGTG 
0121 GCGCCCATCA ATCCGGAGAA GCCCA-TCAA GTATGTGCGC AAGCCCATCG ACTACTCGAT 
0181 GTTGGACGAG ATTGGCCACG GCATTAACTC GGCCCAGCAC TCGCAGGTGC GACAGAAACA 
0241 TCGGGGCTCC AGCCATGGGT CCGTGCAATC CTTATTGCCG CCGTCGGTGG GACCTCCGCC 
0301 AACCACGAAG CCCCCAACTC CGCCGCAGAT GTCGCGAGCT GGGAACACTG GCACACTGGG 
0361 CAAGTCGGTC AGCAATACCG GGACACTGGG CAAGAGTTCG CGGGAGTACC GCACTCCGCC 
0421 TGTGGTCAAT CCACCACAGG TGCCATCGCA CTACGCTCCC AACTATCCTA TTGGGCATCC 
0481 AAAGCGAATG TC-GACGGCT TC 
 Assemble Data

9749R-3.IR_full       1   ATGGAGTCCCAGATGAACCACATCGCCCAGACGGTGCATATCCACAAGGAGAAGGTGGCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9749R-3.in silico     1   ATGGAGTCCCAGATGAACCACATCGCCCAGACGGTGCATATCCACAAGGAGAAGGTGGCC 60


9749R-3.IR_full       61  AGGAGAGAGATTGGCGTGCTTACGGCTAACAAGGTGAGCTCGCGCCAGTTTAAGATCGTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9749R-3.in silico     61  AGGAGAGAGATTGGCGTGCTTACGGCTAACAAGGTGAGCTCGCGCCAGTTTAAGATCGTG 120


9749R-3.IR_full       121 GCGCCCATCAATCCGGAGAAGCCCATTCAAGTATGTGCGCAAGCCCATCGACTACTCGAT 180
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
9749R-3.in silico     121 GCGCCCATCAATCCGGAGAAGCCCA-TCAAGTATGTGCGCAAGCCCATCGACTACTCGAT 180


9749R-3.IR_full       181 GTTGGACGAGATTGGCCACGGCATTAACTCGGCCCAGCACTCGCAGGTGCGACAGAAACA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9749R-3.in silico     181 GTTGGACGAGATTGGCCACGGCATTAACTCGGCCCAGCACTCGCAGGTGCGACAGAAACA 240


9749R-3.IR_full       241 TCGGGGCTCCAGCCATGGGTCCGTGCAATCCTTATTGCCGCCGTCGGTGGGACCTCCGCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9749R-3.in silico     241 TCGGGGCTCCAGCCATGGGTCCGTGCAATCCTTATTGCCGCCGTCGGTGGGACCTCCGCC 300


9749R-3.IR_full       301 AACCACGAAGCCCCCAACTCCGCCGCAGATGTCGCGAGCTGGGAACACTGGCACACTGGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9749R-3.in silico     301 AACCACGAAGCCCCCAACTCCGCCGCAGATGTCGCGAGCTGGGAACACTGGCACACTGGG 360


9749R-3.IR_full       361 CAAGTCGGTCAGCAATACCGGGACACTGGGCAAGAGTTCGCGGGAGTACCGCACTCCGNC 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
9749R-3.in silico     361 CAAGTCGGTCAGCAATACCGGGACACTGGGCAAGAGTTCGCGGGAGTACCGCACTCCGCC 420


9749R-3.IR_full       421 TGTGGTCAATCCACCACAGGTGCCATCGCACTACGCTCCCAACTATCCTATTGGGCATCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9749R-3.in silico     421 TGTGGTCAATCCACCACAGGTGCCATCGCACTACGCTCCCAACTATCCTATTGGGCATCC 480


9749R-3.IR_full       481 AAAGCGAATGTCTGACGGCTTC 502
                          |||||||||||| |||||||||
9749R-3.in silico     481 AAAGCGAATGTC-GACGGCTTC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057915.3  CG9749-RA (Abi), mRNA 
0   NM_057984.3  CG3460-RA (Nmd3), mRNA 
0   NM_079763.2  CG6868-RA (tld), mRNA 
0   NM_132725.2  CG1461-RA (CG1461), mRNA 
0   NM_138041.2  CG4049-RA (CG4049), mRNA 
0   NM_165278.1  CG10501-RB, transcript variant B (amd), mRNA 
0   NM_057244.3  CG10501-RA, transcript variant A (amd), mRNA 
0   NM_164966.2  CG6464-RA (salm), mRNA 
0   NM_166924.1  CG4199-RF, transcript variant F (CG4199), mRNA 
0   NM_166921.1  CG4199-RE, transcript variant E (CG4199), mRNA 
0   NM_166923.1  CG4199-RC, transcript variant C (CG4199), mRNA 
0   NM_130620.2  CG4199-RD, transcript variant D (CG4199), mRNA 
0   NM_166922.1  CG4199-RB, transcript variant B (CG4199), mRNA 
0   NM_166925.1  CG4199-RA, transcript variant A (CG4199), mRNA 
0   NM_001043239.1  CG34108-RA (CG34108), mRNA 
0   NM_058006.3  CG2720-RA (Hop), mRNA 
0   NM_057489.3  CG4722-RA (bib), mRNA 
0   NM_001042869.1  CG34125-RA (CG34125), mRNA 
0   NM_144304.1  CG18662-RA (CG18662), mRNA 
0   NM_079884.3  CG1449-RA (zfh2), mRNA 
0   NM_137975.1  CG30183-RA (CG30183), mRNA 
0   NM_001038725.1  CG40478-RE, transcript variant E (Dyrk3), mRNA 
0   NM_001038723.1  CG40478-RC, transcript variant C (Dyrk3), mRNA 
0   NM_001038721.1  CG40478-RA, transcript variant A (Dyrk3), mRNA 
0   NM_001038724.1  CG40478-RD, transcript variant D (Dyrk3), mRNA 
0   NM_001038722.1  CG40478-RB, transcript variant B (Dyrk3), mRNA 
0   NM_001015080.1  CG40478-PC.3 (CG40478), mRNA 
0   NM_001015079.1  CG40478-PB.3 (CG40478), mRNA 
0   NM_001015078.1  CG40478-PA.3 (CG40478), mRNA 
0   NM_164411.2  CG4896-RB, transcript variant B (CG4896), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.