National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9741R-1 
 Symbol Dhod  Full Name Dihydroorotate dehydrogenase 
 CG No CG9741  Old CG No CG9741 
 Synonyms dhod, DHODH, DHOD, l(3)s3512, CG9741, Dhod 
 Accession No (Link to NCBI) NM_057876.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCTAAAAACGCCACGCGGA 
 Primer Seq. 3'
aatctagaggtaccCTTTTTGCGGAGCAAGCGCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCTAAAAA CGCCACGCGG AGAGTTGGTC GTTTGCGGTC GCTGGGAATC GTTACAGTCG 
0061 GAGGAGCTGC CTTGGTGGCG GGCATTACGG CATACAAGAA CCAGGACCAG TTGTTCCGGA 
0121 CCTTCGTGAT GCCAGCGGTG CGACTTCTTC CGGCGGAAGC CAGCCATCAA CTGGCCGTGC 
0181 TGGCGTGCAA GTACCGCCTG TGCCCGGTTT CACAGTACCA TGATGACCAG AACTTGCACA 
0241 CGTCGTTCTT TGGCCGGATG CTTAGCAATC CCATTGGCAT TGCAGCGGGA TTCGATAAGA 
0301 ACGCGGAGGC GGTGGACGGC CTGCAGGATC TAGGATTCGG ATTTATAGAG GTGGGCACAG 
0361 TTACCCCGGC GGCTCAGGAG GGCAATCCCA AGCCGAGAGT ATTCCGGTTG ACCGAGGACA 
0421 AGGCCATCAT TAATCGGTAC GGATTTAATA GCGACGGGCA TCAGGCCGTG CTCCAACGGC 
0481 TGCGCTTGCT CCGCAAAAAG  
 in silico PCR Fragment
0001 ATGCTAAAAA CGCCACGCGG AGAGTTGGTC GTTTGCGGTC GCTGGGAATC GTTACAGTCG 
0061 GAGGAGCTGC CTTGGTGGCG GGCATTACGG CATACAAGAA CCAGGACCAG TTGTTCCGGA 
0121 CCTTCGTGAT GCCAGCGGTG CGACTTCTTC CGGCGGAAGC CAGCCATCAA CTGGCCGTGC 
0181 TGGCGTGCAA GTACCGCCTG TGCCCGGTTT CACAGTACCA TGATGACCAG AACTTGCACA 
0241 CGTCGTTCTT TGGCCGGATG CTTAGCAATC CCATTGGCAT TGCAGCGGGA TTCGATAAGA 
0301 ACGCGGAGGC GGTGGACGGC CTGCAGGATC TAGGATTCGG ATTTATAGAG GTGGGCACAG 
0361 TTACCCCGGC GGCTCAGGAG GGCAATCCCA AGCCGAGAGT ATTCCGGTTG ACCGAGGACA 
0421 AGGCCATCAT TAATCGGTAC GGATTTAATA GCGACGGGCA TCAGGCCGTG CTCCAACGGC 
0481 TGCGCTTGCT CCGCAAAAAG  
 Assemble Data

9741R-1.IR_full       1   ATGCTAAAAACGCCACGCGGAGAGTTGGTCGTTTGCGGTCGCTGGGAATCGTTACAGTCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9741R-1.in silico     1   ATGCTAAAAACGCCACGCGGAGAGTTGGTCGTTTGCGGTCGCTGGGAATCGTTACAGTCG 60


9741R-1.IR_full       61  GAGGAGCTGCCTTGGTGGCGGGCATTACGGCATACAAGAACCAGGACCAGTTGTTCCGGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9741R-1.in silico     61  GAGGAGCTGCCTTGGTGGCGGGCATTACGGCATACAAGAACCAGGACCAGTTGTTCCGGA 120


9741R-1.IR_full       121 CCTTCGTGATGCCAGCGGTGCGACTTCTTCCGGCGGAAGCCAGCCATCAACTGGCCGTGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9741R-1.in silico     121 CCTTCGTGATGCCAGCGGTGCGACTTCTTCCGGCGGAAGCCAGCCATCAACTGGCCGTGC 180


9741R-1.IR_full       181 TGGCGTGCAAGTACCGCCTGTGCCCGGTTTCACAGTACCATGATGACCAGAACTTGCACA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9741R-1.in silico     181 TGGCGTGCAAGTACCGCCTGTGCCCGGTTTCACAGTACCATGATGACCAGAACTTGCACA 240


9741R-1.IR_full       241 CGTCGTTCTTTGGCCGGATGCTTAGCAATCCCATTGGCATTGCAGCGGGATTCGATAAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9741R-1.in silico     241 CGTCGTTCTTTGGCCGGATGCTTAGCAATCCCATTGGCATTGCAGCGGGATTCGATAAGA 300


9741R-1.IR_full       301 ACGCGGAGGCGGTGGACGGCCTGCAGGATCTAGGATTCGGATTTATAGAGGTGGGCACAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9741R-1.in silico     301 ACGCGGAGGCGGTGGACGGCCTGCAGGATCTAGGATTCGGATTTATAGAGGTGGGCACAG 360


9741R-1.IR_full       361 TTACCCCGGCGGCTCAGGAGGGCAATCCCAAGCCGAGAGTATTCCGGTTGACCGAGGACA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9741R-1.in silico     361 TTACCCCGGCGGCTCAGGAGGGCAATCCCAAGCCGAGAGTATTCCGGTTGACCGAGGACA 420


9741R-1.IR_full       421 AGGCCATCATTAATCGGTACGGATTTAATAGCGACGGGCATCAGGCCGTGCTCCAACGGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9741R-1.in silico     421 AGGCCATCATTAATCGGTACGGATTTAATAGCGACGGGCATCAGGCCGTGCTCCAACGGC 480


9741R-1.IR_full       481 TGCGCTTGCTCCGCAAAAAG 500
                          ||||||||||||||||||||
9741R-1.in silico     481 TGCGCTTGCTCCGCAAAAAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   479  NM_134311.2  CG9741-RC, transcript variant C (Dhod), mRNA 
96.45   462  NM_057876.3  CG9741-RA, transcript variant A (Dhod), mRNA 
95.61   458  NM_169230.1  CG9741-RB, transcript variant B (Dhod), mRNA 
0   NM_143952.1  CG16901-RC, transcript variant C (sqd), mRNA 
0   NM_206481.1  CG16901-RD, transcript variant D (sqd), mRNA 
0   NM_169528.1  CG16901-RB, transcript variant B (sqd), mRNA 
0   NM_143045.2  CG13641-RA (CG13641), mRNA 
0   NM_080109.2  CG3001-RA, transcript variant A (Hex-A), mRNA 
0   NM_167194.1  CG3001-RB, transcript variant B (Hex-A), mRNA 
0   NM_140650.2  CG18217-RA (CG18217), mRNA 
0   NM_140016.2  CG5064-RA (Srp68), mRNA 
0   NM_137588.1  CG15904-RA (CG15904), mRNA 
0   NM_001038808.1  CG17140-RA, transcript variant A (CG17140), mRNA 
0   NM_001038809.1  CG17139-RA, transcript variant A (CG17139), mRNA 
0   NM_140912.2  CG7654-RA (Tom20), mRNA 
0   NM_169513.1  CG9813-RA, transcript variant A (CG9813), mRNA 
0   NM_169514.1  CG9813-RB, transcript variant B (CG9813), mRNA 
0   NM_169516.1  CG9813-RE, transcript variant E (CG9813), mRNA 
0   NM_169515.1  CG9813-RD, transcript variant D (CG9813), mRNA 
0   NM_206210.1  CG5504-RB, transcript variant B (l(2)tid), mRNA 
0   NM_132163.2  CG2079-RA (Dok), mRNA 
0   NM_001014729.1  CG32697-RE, transcript variant E (l(1)G0232), mRNA 
0   NM_167199.1  CG32697-RD, transcript variant D (l(1)G0232), mRNA 
0   NM_167198.1  CG32697-RB, transcript variant B (l(1)G0232), mRNA 
0   NM_132348.2  CG32697-RA, transcript variant A (l(1)G0232), mRNA 
0   NM_001014728.1  CG32697-RF, transcript variant F (l(1)G0232), mRNA 
0   NM_167197.1  CG32697-RC, transcript variant C (l(1)G0232), mRNA 
0   NM_080193.3  CG5504-RA, transcript variant A (l(2)tid), mRNA 
0   NM_206209.1  CG5504-RC, transcript variant C (l(2)tid), mRNA 
0   NM_140424.1  CG9007-RA (CG9007), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.