National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9737R-1 
 Symbol CG9737  Full Name CG9737 
 CG No CG9737  Old CG No CG9737 
 Synonyms SP5, c-SP5, CG9737 
 Accession No (Link to NCBI) NM_143526.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCGGCTGTTTCTACCGCTTC 
 Primer Seq. 3'
aatctagaggtaccCCACTGCAACCGTAGTCATTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTCGGCTGTT TCTACCGCTT CTTGGCTCTG GCCGAGGTCC TGCAGGAGTG CGACATTCCC 
0061 AATGAGACGA AGAGGGGAGT TTGCCTGGAG GTCAGCAGGT GCAAGGCGTA TCTACAGGTG 
0121 CGGAATGCCA CCAATTTGCC GGCGGAGAAG GTTAATTTCC TGAAGAAGGT GCAGTGCGAG 
0181 GTGGAGCAGC AAGTGTCGGA GGCGCAGGGT TCGTACGAAT CACTGGTTTG CTGCCCGGCG 
0241 AATGGCCAGG ATTACCTATT TCCCGTGCTA CAATTCTCTA AGTTCGAGTA CCGAAGATTT 
0301 CTGGATGTTA CCGCTCGATT CAAGCGGAAG AAACTCAAGC GGCGCATTCA AACGGTGGAG 
0361 CCAAGTTCGG GATTCAATTT ACTCAATGAG TGCGGCAAAC AAGTGACTAA TAGGATTTAC 
0421 GGAGGGGAAA TCGCCGAACT GGATGAGTTT CCTTGGCTGG CACTGCTTGT CTACAACTCG 
0481 AATGACTACG GTTGCAGTGG  
 in silico PCR Fragment
0001 TTCGGCTGTT TCTACCGCTT CTTGGCTCTG GCCGAGGTCC TGCAGGAGTG CGACATTCCC 
0061 AATGAGACGA AGAGGGGAGT TTGCCTGGAG GTCAGCAGGT GCAAGGCGTA TCTACAGGTG 
0121 CGGAATGCCA CCAATTTGCC GGCGGAGAAG GTTAATTTCC TGAAGAAGGT GCAGTGCGAG 
0181 GTGGAGCAGC AAGTGTCGGA GGCGCAGGGT TCGTACGAAT CACTGGTTTG CTGCCCGGCG 
0241 AATGGCCAGG ATTACCTATT TCCCGTGCTA CAATTCTCTA AGTTCGAGTA CCGAAGATTT 
0301 CTGGATGTTA CCGCTCGATT CAAGCGGAAG AAACTCAAGC GGCGCATTCA AACGGTGGAG 
0361 CCAAGTTCGG GATTCAATTT ACTCAATGAG TGCGGCAAAC AAGTGACTAA TAGGATTTAC 
0421 GGAGGGGAAA TCGCCGAACT GGATGAGTTT CCTTGGCTGG CACTGCTTGT CTACAACTCG 
0481 AATGACTACG GTTGCAGTGG  
 Assemble Data

9737R-1.IR_full       1   TTCGGCTGTTTCTACCGCTTCTTGGCTCTGGCCGAGGTCCTGCAGGAGTGCGACATTCCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9737R-1.in silico     1   TTCGGCTGTTTCTACCGCTTCTTGGCTCTGGCCGAGGTCCTGCAGGAGTGCGACATTCCC 60


9737R-1.IR_full       61  AATGAGACGAAGAGGGGAGTTTGCCTGGAGGTCAGCAGGTGCAAGGCGTATCTACAGGTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9737R-1.in silico     61  AATGAGACGAAGAGGGGAGTTTGCCTGGAGGTCAGCAGGTGCAAGGCGTATCTACAGGTG 120


9737R-1.IR_full       121 CGGAATGCCACCAATTTGCCGGCGGAGAAGGTTAATTTCCTGAAGAAGGTGCAGTGCGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9737R-1.in silico     121 CGGAATGCCACCAATTTGCCGGCGGAGAAGGTTAATTTCCTGAAGAAGGTGCAGTGCGAG 180


9737R-1.IR_full       181 GTGGAGCAGCAAGTGTCGGAGGCGCAGGGTTCGTACGAATCACTGGTTTGCTGCCCGGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9737R-1.in silico     181 GTGGAGCAGCAAGTGTCGGAGGCGCAGGGTTCGTACGAATCACTGGTTTGCTGCCCGGCG 240


9737R-1.IR_full       241 AATGGCCAGGATTACCTATTTCCCGTGCTACAATTCTCTAAGTTCGAGTACCGAAGATTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9737R-1.in silico     241 AATGGCCAGGATTACCTATTTCCCGTGCTACAATTCTCTAAGTTCGAGTACCGAAGATTT 300


9737R-1.IR_full       301 CTGGATGTTACCGCTCGATTCAAGCGGAAGAAACTCAAGCGGCGCATTCAAACGGTGGAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9737R-1.in silico     301 CTGGATGTTACCGCTCGATTCAAGCGGAAGAAACTCAAGCGGCGCATTCAAACGGTGGAG 360


9737R-1.IR_full       361 CCAAGTTCGGGATTCAATTTACTCAATGAGTGCGGCAAACAAGTGACTAATAGGATTTAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9737R-1.in silico     361 CCAAGTTCGGGATTCAATTTACTCAATGAGTGCGGCAAACAAGTGACTAATAGGATTTAC 420


9737R-1.IR_full       421 GGAGGGGAAATCGCCGAACTGGATGAGTTTCCTTGGCTGGCACTGCTTGTCTACAACTCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9737R-1.in silico     421 GGAGGGGAAATCGCCGAACTGGATGAGTTTCCTTGGCTGGCACTGCTTGTCTACAACTCG 480


9737R-1.IR_full       481 AATGACTACGGTTGCAGTGG 500
                          ||||||||||||||||||||
9737R-1.in silico     481 AATGACTACGGTTGCAGTGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143526.1  CG9737-RA (CG9737), mRNA 
0   NM_169801.1  CG31241-RA (CG31241), mRNA 
0   NM_135809.1  CG16848-RA (CG16848), mRNA 
0   NM_134943.1  CG3213-RA (CG3213), mRNA 
0   NM_134511.1  CG12702-RA (CG12702), mRNA 
0   NM_134825.3  CG9967-RA, transcript variant A (CG9967), mRNA 
0   NM_001014461.1  CG9967-RB, transcript variant B (CG9967), mRNA 
0   NM_164443.1  CG31665-RA, transcript variant A (CG31665), mRNA 
0   NM_205889.1  CG31665-RB, transcript variant B (CG31665), mRNA 
0   10  NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0   10  NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
0   NM_170450.1  CG31036-RA (CG31036), mRNA 
0   NM_133011.2  CG8173-RA (CG8173), mRNA 
0   NM_169333.2  CG3985-RE, transcript variant E (Syn), mRNA 
0   NM_169334.2  CG3985-RD, transcript variant D (Syn), mRNA 
0   NM_176451.2  CG3985-RF, transcript variant F (Syn), mRNA 
0   NM_169332.2  CG3985-RA, transcript variant A (Syn), mRNA 
0   NM_169335.2  CG3985-RC, transcript variant C (Syn), mRNA 
0   NM_140606.1  CG13046-RA (CG13046), mRNA 
0   NM_137214.3  CG30084-RA, transcript variant A (CG30084), mRNA 
0   NM_145757.2  CG30084-RC, transcript variant C (CG30084), mRNA 
0   NM_135156.2  CG13991-RA (CG13991), mRNA 
0   NM_168290.1  CG5939-RB, transcript variant B (Prm), mRNA 
0   NM_168291.1  CG5939-RC, transcript variant C (Prm), mRNA 
0   NM_079258.2  CG5939-RA, transcript variant A (Prm), mRNA 
0   NM_168292.1  CG5939-RD, transcript variant D (Prm), mRNA 
0   NM_135938.2  CG4935-RA (CG4935), mRNA 
0   10  NM_141696.1  CG8526-RA (CG8526), mRNA 
0   NM_079985.2  CG5206-RA (bon), mRNA 
0   NM_167265.1  CG2061-RC, transcript variant C (CG2061), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.