National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9720R-2 
 Symbol PH4alphaNE2  Full Name prolyl-4-hydroxylase-alpha NE2 
 CG No CG9720  Old CG No CG9720 
 Synonyms CG9720, PH4alphaNE2 
 Accession No (Link to NCBI) NM_170499.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCTCTATCTGTCCCTGAGT 
 Primer Seq. 3'
aatctagaggtaccGCGAGACAATCGATGGGTTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGCTCTATC TGTCCCTGAG TTTTGGCCAG TTGCGAGAGA ACAATGCCCA ACAGCGCTTT 
0061 GCAAGATCCG TGGTGAATAT GGATGATATG CTGAACTTAG AGGACGATCT TGTCTCAAAT 
0121 GTGGAAAAGC TGGCGGAANG CGCTTGCCCG AAAAGCCAAA ACCATTAAAT GGGGTGTCTT 
0181 CAAGATGATG AAAAGGCGAC AGGAGTATAA GACGTCTATG GAACTTTTTG CCAATCCGAT 
0241 TGACACCTTT TCCCTCATTC GTCACATGCA GTCGGACTGG TTGATGTGGC TATTGTACTT 
0301 GGAAATGCCT GTTGGCCAAG AGGAATTGGT CTTTGTGGAC TCAAGGATGC CCCTATTGCC 
0361 AAAGTACTTT GACTTTATAG ATGCCGCTGA AGGCATTAGA AAAATGCAGG CCACATACCA 
0421 GATGTTTTCC TCAGATATAG CCAAAGGCTT ACTAGATGGA GTGCAATACA ACTCTTCTCT 
0481 AAAACCCATC GATTGTNCNC Gc 
 in silico PCR Fragment
0001 ATGCTCTATC TGTCCCTGAG TTTTGGCCAG TTGCGAGAGA ACAATGCCCA ACAGCGCTTT 
0061 GCAAGATCTG TGGTGAATAT GGATGATATG CTGAACTTAG AGGACGATCT TGTCTCAAAT 
0121 GTGGAAAAGC TGGCGGAA-G CGCTTGCACG AAAAGCCAAA ACCATTAAAT GGGGCGTCTT 
0181 CAAGATGATG AAAAGGCGAC AGGAGTATAA GTCGTCTATG GAAATTTTTG CCAATCCGAT 
0241 TGACACCTTT TCCCTCATTC GTCACATGCA GTCGAACTGG TTGATGTGGC TATTGTACTT 
0301 GGAAACGCCT GTTGGCCAAG AGGAATTGTT TTTTGTGGAC TCAAGGATGC CCCTATTGCC 
0361 AAAGTACTTT GACTTTATAG ATGCCGCTGA AGGCATTAGA AAAATGCAGG CCACATACCA 
0421 GATGTTTTCC TCAGATATAG CCAAAGGCTT ACTAGATGGA GTGCAATACA ACTCTTCTCT 
0481 AAAACCCATC GATTGT-CTC GC 
 Assemble Data

9720R-2.IR_full        1   TGCTCTATCTGTCCCTGAGTTTTGGCCAGTTGCGAGAGAACAATGCCCAACAGCGCTTT 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9720R-2.in silico      1   TGCTCTATCTGTCCCTGAGTTTTGGCCAGTTGCGAGAGAACAATGCCCAACAGCGCTTT 59


9720R-2.IR_full       61  GCAAGATCCGTGGTGAATATGGATGATATGCTGAACTTAGAGGACGATCTTGTCTCAAAT 119
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
9720R-2.in silico     61  GCAAGATCTGTGGTGAATATGGATGATATGCTGAACTTAGAGGACGATCTTGTCTCAAAT 119


9720R-2.IR_full       121 GTGGAAAAGCTGGCGGAANGCGCTTGCCCGAAAAGCCAAAACCATTAAATGGGGTGTCTT 179
                          |||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||||
9720R-2.in silico     121 GTGGAAAAGCTGGCGGAA-GCGCTTGCACGAAAAGCCAAAACCATTAAATGGGGCGTCTT 179


9720R-2.IR_full       181 CAAGATGATGAAAAGGCGACAGGAGTATAAGACGTCTATGGAACTTTTTGCCAATCCGAT 239
                          ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
9720R-2.in silico     181 CAAGATGATGAAAAGGCGACAGGAGTATAAGTCGTCTATGGAAATTTTTGCCAATCCGAT 239


9720R-2.IR_full       241 TGACACCTTTTCCCTCATTCGTCACATGCAGTCGGACTGGTTGATGTGGCTATTGTACTT 299
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
9720R-2.in silico     241 TGACACCTTTTCCCTCATTCGTCACATGCAGTCGAACTGGTTGATGTGGCTATTGTACTT 299


9720R-2.IR_full       301 GGAAATGCCTGTTGGCCAAGAGGAATTGGTCTTTGTGGACTCAAGGATGCCCCTATTGCC 359
                          ||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||
9720R-2.in silico     301 GGAAACGCCTGTTGGCCAAGAGGAATTGTTTTTTGTGGACTCAAGGATGCCCCTATTGCC 359


9720R-2.IR_full       361 AAAGTACTTTGACTTTATAGATGCCGCTGAAGGCATTAGAAAAATGCAGGCCACATACCA 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9720R-2.in silico     361 AAAGTACTTTGACTTTATAGATGCCGCTGAAGGCATTAGAAAAATGCAGGCCACATACCA 419


9720R-2.IR_full       421 GATGTTTTCCTCAGATATAGCCAAAGGCTTACTAGATGGAGTGCAATACAACTCTTCTCT 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9720R-2.in silico     421 GATGTTTTCCTCAGATATAGCCAAAGGCTTACTAGATGGAGTGCAATACAACTCTTCTCT 479


9720R-2.IR_full       481 AAAACCCATCGATTGTNCNCGC 501
                          |||||||||||||||| | |||
9720R-2.in silico     481 AAAACCCATCGATTGT-CTCGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_170499.2  CG9720-RA (PH4alphaNE2), mRNA 
3.11   15  12  41  NM_170500.2  CG31524-RA, transcript variant A (CG31524), mRNA 
3.11   15  12  41  NM_001043312.1  CG31524-RB, transcript variant B (CG31524), mRNA 
0.2   NM_078803.1  CG4105-RA (Cyp4e3), mRNA 
0   NM_170516.1  CG31015-RA (PH4alphaPV), mRNA 
0   NM_143452.1  CG1911-RA (CAP-D2), mRNA 
0   NM_135717.2  CG6504-RA (Pkd2), mRNA 
0   NM_132437.1  CG15207-RA (CG15207), mRNA 
0   NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
0   NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
0   NM_176244.1  CG9696-RE, transcript variant E (dom), mRNA 
0   NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_079884.3  CG1449-RA (zfh2), mRNA 
0   NM_079395.2  CG9695-RA (Dab), mRNA 
0   NM_170339.1  CG5643-RE, transcript variant E (wdb), mRNA 
0   NM_138235.1  CG13912-RA (CG13912), mRNA 
0   NM_079206.2  CG7503-RA (Con), mRNA 
0   NM_170340.1  CG5643-RF, transcript variant F (wdb), mRNA 
0   NM_170337.1  CG5643-RB, transcript variant B (wdb), mRNA 
0   NM_170338.1  CG5643-RD, transcript variant D (wdb), mRNA 
0   NM_143312.2  CG5643-RC, transcript variant C (wdb), mRNA 
0   NM_140941.1  CG13814-RA (CG13814), mRNA 
0   NM_170341.1  CG5643-RG, transcript variant G (wdb), mRNA 
0   NM_170336.1  CG5643-RA, transcript variant A (wdb), mRNA 
0   NM_165075.1  CG31839-RA (CG31839), mRNA 
0   NM_143091.1  CG13653-RA (CG13653), mRNA 
0   NM_141115.1  CG14562-RA (CG14562), mRNA 
0   NM_168975.1  CG10712-RB, transcript variant B (Chro), mRNA 
0   NM_168976.1  CG10712-RC, transcript variant C (Chro), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.