National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9676R-3 
 Symbol CG9676  Full Name CG9676 
 CG No CG9676  Old CG No CG9676 
 Synonyms SP99, CG9676 
 Accession No (Link to NCBI) NM_167535.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCTACTCGTCCTTTGCGCAG 
 Primer Seq. 3'
aatctagaggtaccGATGTCCACGGTGGCATCGTT 
 Predicted Fragment Size
428 
 IR fragment full Seq
0001 CTCTACTCGT CCTTTGCGCA GTCCGGAGTC CTGGCACAAA ACGATTCCGT AGTGGAGCCC 
0061 CGCATTGTGG GCGGCACCAA GGCGAGGGAG GGTCAGTTTC CTCACCAGAT CTCACTACGT 
0121 CGACGTGGAA GCCACACTTG TGGTGGCTCC ATAATCTCCA AGGACTACGT TGTCACCGCC 
0181 GCCCATTGCG TTAAGCAAGG CAACAATGTA GCTCCAGCTA ATGAGCTGGA GATTCAGGCG 
0241 GGCAGCCTGC TCCTTTCCAG CGGAGGAGTT CGCGTTCCAG TGGCCACCGT CACCGTGCAT 
0301 CCCAATTACA ACTCCAATGG CCACGATGTC GCCGTGCTGC GACTTCGCAA CTCGCTGACC 
0361 TTTAACTCCA ACATAGCCGC CATCAAGCTG GCCACCGAAG ATCCGCCCAA CGATGCCACC 
0421 GTGGACATC 
 in silico PCR Fragment
0001 CTCTACTCGT CCTTTGCGCA G-CCGGAGTC CTGGCACAAA ACGATTCCGT AGTGGAGCCC 
0061 CGCATTGTGG GCGGCACCAA GGCGAGGGAG GGTCAGTTTC CTCACCAGAT CTCACTACGT 
0121 CGACGTGGAA GCCACACTTG TGGTGGCTCC ATAATCTCCA AGGACTACGT TGTCACCGCC 
0181 GCCCATTGCG TTAAGCAAGG CAACAATGTA GCTCCAGCTA ATGAGCTGGA GATTCAGGCG 
0241 GGCAGCCTGC TCCTTTCCAG CGGAGGAGTT CGCGTTCCAG TGGCCACCGT CACCGTGCAT 
0301 CCCAATTACA ACTCCAATGG CCACGATGTC GCCGTGCTGC GACTTCGCAA CTCGCTGACC 
0361 TTTAACTCCA ACATAGCCGC CATCAAGCTG GCCACCGAAG ATCCGCCCAA CGATGCCACC 
0421 GTGGACATC 
 Assemble Data

9676R-3.IR_full       1   CTCTACTCGTCCTTTGCGCAGTCCGGAGTCCTGGCACAAAACGATTCCGTAGTGGAGCCC 60
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
9676R-3.in silico     1   CTCTACTCGTCCTTTGCGCAG-CCGGAGTCCTGGCACAAAACGATTCCGTAGTGGAGCCC 60


9676R-3.IR_full       61  CGCATTGTGGGCGGCACCAAGGCGAGGGAGGGTCAGTTTCCTCACCAGATCTCACTACGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9676R-3.in silico     61  CGCATTGTGGGCGGCACCAAGGCGAGGGAGGGTCAGTTTCCTCACCAGATCTCACTACGT 120


9676R-3.IR_full       121 CGACGTGGAAGCCACACTTGTGGTGGCTCCATAATCTCCAAGGACTACGTTGTCACCGCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9676R-3.in silico     121 CGACGTGGAAGCCACACTTGTGGTGGCTCCATAATCTCCAAGGACTACGTTGTCACCGCC 180


9676R-3.IR_full       181 GCCCATTGCGTTAAGCAAGGCAACAATGTAGCTCCAGCTAATGAGCTGGAGATTCAGGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9676R-3.in silico     181 GCCCATTGCGTTAAGCAAGGCAACAATGTAGCTCCAGCTAATGAGCTGGAGATTCAGGCG 240


9676R-3.IR_full       241 GGCAGCCTGCTCCTTTCCAGCGGAGGAGTTCGCGTTCCAGTGGCCACCGTCACCGTGCAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9676R-3.in silico     241 GGCAGCCTGCTCCTTTCCAGCGGAGGAGTTCGCGTTCCAGTGGCCACCGTCACCGTGCAT 300


9676R-3.IR_full       301 CCCAATTACAACTCCAATGGCCACGATGTCGCCGTGCTGCGACTTCGCAACTCGCTGACC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9676R-3.in silico     301 CCCAATTACAACTCCAATGGCCACGATGTCGCCGTGCTGCGACTTCGCAACTCGCTGACC 360


9676R-3.IR_full       361 TTTAACTCCAACATAGCCGCCATCAAGCTGGCCACCGAAGATCCGCCCAACGATGCCACC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9676R-3.in silico     361 TTTAACTCCAACATAGCCGCCATCAAGCTGGCCACCGAAGATCCGCCCAACGATGCCACC 420


9676R-3.IR_full       421 GTGGACATC 429
                          |||||||||
9676R-3.in silico     421 GTGGACATC 429

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   410  NM_167535.1  CG9676-RA (CG9676), mRNA 
0   11  34  29  NM_167738.1  CG32523-RA (CG32523), mRNA 
0   NM_165709.1  CG1516-RI, transcript variant I (CG1516), mRNA 
0   NM_136683.2  CG1516-RE, transcript variant E (CG1516), mRNA 
0   NM_165705.1  CG1516-RA, transcript variant A (CG1516), mRNA 
0   NM_165710.1  CG1516-RJ, transcript variant J (CG1516), mRNA 
0   NM_165707.1  CG1516-RD, transcript variant D (CG1516), mRNA 
0   NM_165706.1  CG1516-RB, transcript variant B (CG1516), mRNA 
0   NM_165711.1  CG1516-RK, transcript variant K (CG1516), mRNA 
0   NM_165708.1  CG1516-RG, transcript variant G (CG1516), mRNA 
0   NM_165712.1  CG1516-RL, transcript variant L (CG1516), mRNA 
0   12  NM_001038864.1  CG4927-RC (CG4927), mRNA 
0   NM_140450.1  CG4613-RA (CG4613), mRNA 
0   NM_132493.2  CG11715-RA, transcript variant A (Cyp4g15), mRNA 
0   NM_167287.1  CG11715-RB, transcript variant B (Cyp4g15), mRNA 
0   NM_169193.1  CG3066-RB, transcript variant B (Sp7), mRNA 
0   NM_141477.2  CG3066-RA, transcript variant A (Sp7), mRNA 
0   NM_169192.2  CG3066-RC, transcript variant C (Sp7), mRNA 
0   NM_206457.1  CG3066-RD, transcript variant D (Sp7), mRNA 
0   NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
0   NM_176278.2  CG33160-RA (CG33160), mRNA 
0   NM_132054.1  CG6048-RA (CG6048), mRNA 
0   NM_138055.1  CG30419-RA (CG30419), mRNA 
0   NM_079819.2  CG9983-RB, transcript variant B (Hrb98DE), mRNA 
0   NM_170374.1  CG9983-RF, transcript variant F (Hrb98DE), mRNA 
0   NM_170372.1  CG9983-RC, transcript variant C (Hrb98DE), mRNA 
0   NM_170373.1  CG9983-RD, transcript variant D (Hrb98DE), mRNA 
0   NM_135239.1  CG18304-RA (CG18304), mRNA 
0   NM_165110.1  CG11861-RB, transcript variant B (gft), mRNA 
0   NM_078849.1  CG11861-RA, transcript variant A (gft), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.