National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9676R-1 
 Symbol CG9676  Full Name CG9676 
 CG No CG9676  Old CG No CG9676 
 Synonyms SP99, CG9676 
 Accession No (Link to NCBI) NM_167535.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| silico     1   CTCTACTCGTCCTTTGCGCAG-CCGGAGTCCTGGCACAAAACGATTCCGTAGTGGAGCCC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGCATTGTGGGCGGCACCAAGGCGAGGGAGGGTCAGTTTCCTCACCAGATCTCACTACGT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGACGTGGAAGCCACACTTGTGGTGGCTCCATAATCTCCAAGGACTACGTTGTCACCGCC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCCCATTGCGTTAAGCAAGGCAACAATGTAGCTCCAGCTAATGAGCTGGAGATTCAGGCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGCAGCCTGCTCCTTTCCAGCGGAGGAGTTCGCGTTCCAGTGGCCACCGTCACCGTGCAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCCAATTACAACTCCAATGGCCACGATGTCGCCGTGCTGCGACTTCGCAACTCGCTGACC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTTAACTCCAACATAGCCGCCATCAAGCTGGCCACCGAAGATCCGCCCAACGATGCCACC 420

9676R-1.IR_full       421 GTGGACATC 429
                          ||||||||| silico     421 GTGGACATC 429

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   410  NM_167535.1  CG9676-RA (CG9676), mRNA 
0   11  34  29  NM_167738.1  CG32523-RA (CG32523), mRNA 
0   NM_165709.1  CG1516-RI, transcript variant I (CG1516), mRNA 
0   NM_136683.2  CG1516-RE, transcript variant E (CG1516), mRNA 
0   NM_165705.1  CG1516-RA, transcript variant A (CG1516), mRNA 
0   NM_165710.1  CG1516-RJ, transcript variant J (CG1516), mRNA 
0   NM_165707.1  CG1516-RD, transcript variant D (CG1516), mRNA 
0   NM_165706.1  CG1516-RB, transcript variant B (CG1516), mRNA 
0   NM_165711.1  CG1516-RK, transcript variant K (CG1516), mRNA 
0   NM_165708.1  CG1516-RG, transcript variant G (CG1516), mRNA 
0   NM_165712.1  CG1516-RL, transcript variant L (CG1516), mRNA 
0   12  NM_001038864.1  CG4927-RC (CG4927), mRNA 
0   NM_140450.1  CG4613-RA (CG4613), mRNA 
0   NM_132493.2  CG11715-RA, transcript variant A (Cyp4g15), mRNA 
0   NM_167287.1  CG11715-RB, transcript variant B (Cyp4g15), mRNA 
0   NM_169193.1  CG3066-RB, transcript variant B (Sp7), mRNA 
0   NM_141477.2  CG3066-RA, transcript variant A (Sp7), mRNA 
0   NM_169192.2  CG3066-RC, transcript variant C (Sp7), mRNA 
0   NM_206457.1  CG3066-RD, transcript variant D (Sp7), mRNA 
0   NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
0   NM_176278.2  CG33160-RA (CG33160), mRNA 
0   NM_132054.1  CG6048-RA (CG6048), mRNA 
0   NM_138055.1  CG30419-RA (CG30419), mRNA 
0   NM_079819.2  CG9983-RB, transcript variant B (Hrb98DE), mRNA 
0   NM_170374.1  CG9983-RF, transcript variant F (Hrb98DE), mRNA 
0   NM_170372.1  CG9983-RC, transcript variant C (Hrb98DE), mRNA 
0   NM_170373.1  CG9983-RD, transcript variant D (Hrb98DE), mRNA 
0   NM_135239.1  CG18304-RA (CG18304), mRNA 
0   NM_165110.1  CG11861-RB, transcript variant B (gft), mRNA 
0   NM_078849.1  CG11861-RA, transcript variant A (gft), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.