National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9673R-3 
 Symbol CG9673  Full Name CG9673 
 CG No CG9673  Old CG No CG9673 
 Synonyms SPH81, CG9673 
 Accession No (Link to NCBI) NM_132921.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATTCTTGGCGGCGAGGACGTT 
 Primer Seq. 3'
aatctagaggtaccTATCCGGCTTCCCATTCGCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATTCTTGGCG GCGAGGACGT TGCCCAgGGC GAGTACCCCT GGTCCGCATC CGTGAGATAC 
0061 AACAAGGCCC ACGTTCTGCT CCGGCGCCAT CATCTCAACA AACCACATCC TGACCGCCGC 
0121 CCACTGTGTG TCCAGGCGTG GGCATCACCC CAGTGGATGC CAGCACCTTG GCTGTTCGCC 
0181 TGGGCACCAT TAACCAGTAC GCCGGCGGCA GCATTGTGAA TGTAAAGAGC GTGATCATCC 
0241 ATCCATCGTA CGGAAACTTC CTGCACGACA TCGCCATACT GGAGCTGGAC GAGACCCTGG 
0301 TCTTTAGCGA TCGCATCCAA GACATCGCAC TGCCCCCCAC AACTGATGAG GAGACGGAAG 
0361 ATGTGGACGC TGAGCTGCCC AACGGAACTC CGGTCTATGT GGCTGGATGG GGTGAACTTT 
0421 CGGATGGTAC TGCATCCTAT AAACAGCAGA AGGCCAACTA CAATACGCTG AGCCGATCCC 
0481 TGTGCGAATG GGAAGCCGGA TA 
 in silico PCR Fragment
0001 ATTCTTGGCG GCGAGGACGT TGCCCAGGGC GAGTACCCCT GGTCCGCATC CGTGAGATAC 
0061 AACAAGGCCC ACG-TCTGCT CCGGCGCCAT CATCTCAACA AACCACATCC TGACCGCCGC 
0121 CCACTGTGTG TCCA-GCGTG GGCATCACCC CAGTGGATGC CAGCACCTTG GCTGTTCGCC 
0181 TGGGCACCAT TAACCAGTAC GCCGGCGGCA GCATTGTGAA TGTAAAGAGC GTGATCATCC 
0241 ATCCATCGTA CGGAAACTTC CTGCACGACA TCGCCATACT GGAGCTGGAC GAGACCCTGG 
0301 TCTTTAGCGA TCGCATCCAA GACATCGCAC TGCCCCCCAC AACTGATGAG GAGACGGAAG 
0361 ATGTGGACGC TGAGCTGCCC AACGGAACTC CGGTCTATGT GGCTGGATGG GGTGAACTTT 
0421 CGGATGGTAC TGCATCCTAT AAACAGCAGA AGGCCAACTA CAATACGCTG AGCCGATCCC 
0481 TGTGCGAATG GGAAGCCGGA TA 
 Assemble Data

9673R-3.IR_full       1   ATTCTTGGCGGCGAGGACGTTGCCCAGGGCGAGTACCCCTGGTCCGCATCCGTGAGATAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9673R-3.in silico     1   ATTCTTGGCGGCGAGGACGTTGCCCAGGGCGAGTACCCCTGGTCCGCATCCGTGAGATAC 60


9673R-3.IR_full       61  AACAAGGCCCACGTTCTGCTCCGGCGCCATCATCTCAACAAACCACATCCTGACCGCCGC 120
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
9673R-3.in silico     61  AACAAGGCCCACG-TCTGCTCCGGCGCCATCATCTCAACAAACCACATCCTGACCGCCGC 120


9673R-3.IR_full       121 CCACTGTGTGTCCAGGCGTGGGCATCACCCCAGTGGATGCCAGCACCTTGGCTGTTCGCC 180
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
9673R-3.in silico     121 CCACTGTGTGTCCA-GCGTGGGCATCACCCCAGTGGATGCCAGCACCTTGGCTGTTCGCC 180


9673R-3.IR_full       181 TGGGCACCATTAACCAGTACGCCGGCGGCAGCATTGTGAATGTAAAGAGCGTGATCATCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9673R-3.in silico     181 TGGGCACCATTAACCAGTACGCCGGCGGCAGCATTGTGAATGTAAAGAGCGTGATCATCC 240


9673R-3.IR_full       241 ATCCATCGTACGGAAACTTCCTGCACGACATCGCCATACTGGAGCTGGACGAGACCCTGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9673R-3.in silico     241 ATCCATCGTACGGAAACTTCCTGCACGACATCGCCATACTGGAGCTGGACGAGACCCTGG 300


9673R-3.IR_full       301 TCTTTAGCGATCGCATCCAAGACATCGCACTGCCCCCCACAACTGATGAGGAGACGGAAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9673R-3.in silico     301 TCTTTAGCGATCGCATCCAAGACATCGCACTGCCCCCCACAACTGATGAGGAGACGGAAG 360


9673R-3.IR_full       361 ATGTGGACGCTGAGCTGCCCAACGGAACTCCGGTCTATGTGGCTGGATGGGGTGAACTTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9673R-3.in silico     361 ATGTGGACGCTGAGCTGCCCAACGGAACTCCGGTCTATGTGGCTGGATGGGGTGAACTTT 420


9673R-3.IR_full       421 CGGATGGTACTGCATCCTATAAACAGCAGAAGGCCAACTACAATACGCTGAGCCGATCCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9673R-3.in silico     421 CGGATGGTACTGCATCCTATAAACAGCAGAAGGCCAACTACAATACGCTGAGCCGATCCC 480


9673R-3.IR_full       481 TGTGCGAATGGGAAGCCGGATA 502
                          ||||||||||||||||||||||
9673R-3.in silico     481 TGTGCGAATGGGAAGCCGGATA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132921.1  CG9673-RA (CG9673), mRNA 
1.24   NM_143287.1  CG5909-RA (CG5909), mRNA 
0.2   NM_138066.2  CG15873-RA (CG15873), mRNA 
0.2   NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0.2   NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0.2   NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0   NM_132920.1  CG9675-RA (CG9675), mRNA 
0   13  NM_169868.1  CG31220-RA (CG31220), mRNA 
0   NM_140450.1  CG4613-RA (CG4613), mRNA 
0   NM_167161.1  CG2056-RB, transcript variant B (CG2056), mRNA 
0   NM_132264.2  CG2056-RA, transcript variant A (CG2056), mRNA 
0   NM_138238.1  CG13913-RA (CG13913), mRNA 
0   NM_135004.1  CG3355-RA, transcript variant A (CG3355), mRNA 
0   NM_164594.1  CG3355-RB, transcript variant B (CG3355), mRNA 
0   NM_079614.2  CG7996-RA (snk), mRNA 
0   NM_142086.2  CG9649-RA (CG9649), mRNA 
0   NM_170505.1  CG1539-RF, transcript variant F (tmod), mRNA 
0   NM_170503.1  CG1539-RD, transcript variant D (tmod), mRNA 
0   NM_170504.1  CG1539-RE, transcript variant E (tmod), mRNA 
0   NM_078969.3  CG12385-RA (thetaTry), mRNA 
0   NM_142054.1  CG14365-RA (CG14365), mRNA 
0   NM_133095.1  CG6891-RA, transcript variant A (CG6891), mRNA 
0   NM_166886.1  CG32808-RA (CG32808), mRNA 
0   NM_136265.2  CG17571-RA (CG17571), mRNA 
0   NM_132030.1  CG15770-RA (CG15770), mRNA 
0   NM_139590.2  CG1134-RA (CG1134), mRNA 
0   NM_079400.2  CG7659-RA (tap), mRNA 
0   NM_136257.2  CG8677-RA (CG8677), mRNA 
0   NM_057967.3  CG8729-RA, transcript variant A (rnh1), mRNA 
0   NM_206055.1  CG8729-RB, transcript variant B (rnh1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.