National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9672R-1 
 Symbol CG9672  Full Name CG9672 
 CG No CG9672  Old CG No CG9672 
 Synonyms SPH161, BcDNA:GH16384, CG9672 
 Accession No (Link to NCBI) NM_132923.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGAAGCTGACCCTCACCATT 
 Primer Seq. 3'
aatctagaggtaccTCCTATTTGCAGGGTGCGATG 
 Predicted Fragment Size
501 
 IR fragment full Seq
0001 ATGAAGCTGA CCCTCACCAT TGGACTAATC CTTGTGGCCG CCGGAGTTCT GGAGGcCCAG 
0061 CCGCAggGNA GGATCGCCGG TGGAGAAGAT GCCGTTCTCG gcCAGCTGCC CTACCAGGCG 
0121 GCCCTCTCCA TCGGCGGAAG CTACANACTG CGGCGCCGTG ATCATTGGCC AGCGATACGC 
0181 CCTCACCGCC CTCTCTTGCG TCTGCTCCGA CGGCAAGGAT ACCCCATGGG CTGCTGTTCT 
0241 GTTCGCCGTG ACCGTAGGAT CGGTGGATCT CTACAATGGC AAGCAGATTC GCGTGGAGGA 
0301 GATCACCATT AACCCGAACT ACAGCACTCT GAAGACCGGA ANCGCCCTGC TCCGTCTGCA 
0361 GGAGGAGATT ACTTTCAGTG AGACAGTCAA TGCCATTCCA CTCTCCCAGG ATCGttCCGC 
0421 NCATGGGCAG GCCAGGTGGA GGTcTCCGGN CTGGGGCCGC ACCACCGAGT CCGAGGTGAA 
0481 CATGCATCGC ACCCTGCAAA TAGGA 
 in silico PCR Fragment
0001 ATGAAGCTGA CCCTCACCAT TGGACTAATC CTTGTGGCCG CCGGAGTTCT GGAGGCCCAG 
0061 CCGCAGGGCA GGATCGCCGG TGGAGAAGAT GCCGTTCTCG GCCAGCTGCC CTACCAGGCG 
0121 GCCCTCTCCA TCGGCGGAAG CTACA-ACTG CGGCGCCGTG ATCATTGGCC AGCGATACGC 
0181 CCTCACCGCC CTCTCTTGCG TCTGCTCCGA CGGCAAGGAT ACCCCATGGG CTGCTGTTCT 
0241 GTTCGCCGTG ACCGTAGGAT CGGTGGATCT CTACAATGGC AAGCAGATTC GCGTGGAGGA 
0301 GATCACCATT AACCCGAACT ACAGCACTCT GAAGACCGGA ATCGCCCTGC TCCGTCTGCA 
0361 GGAGGAGATT ACTTTCAGTG AGACAGTCAA TGCCATTCCA CTCTCCCAGG A-CGTTCCGC 
0421 CCATGGGCA- GCCAGGTGGA GGTCTCCGG- CTGGGGCCGC ACCACCGAGT CCGAGGTGAA 
0481 CATGCATCGC ACCCTGCAAA TAGGA 
 Assemble Data

9672R-1.IR_full       1   ATGAAGCTGACCCTCACCATTGGACTAATCCTTGTGGCCGCCGGAGTTCTGGAGGCCCAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9672R-1.in silico     1   ATGAAGCTGACCCTCACCATTGGACTAATCCTTGTGGCCGCCGGAGTTCTGGAGGCCCAG 60


9672R-1.IR_full       61  CCGCAGGGNAGGATCGCCGGTGGAGAAGATGCCGTTCTCGGCCAGCTGCCCTACCAGGCG 120
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
9672R-1.in silico     61  CCGCAGGGCAGGATCGCCGGTGGAGAAGATGCCGTTCTCGGCCAGCTGCCCTACCAGGCG 120


9672R-1.IR_full       121 GCCCTCTCCATCGGCGGAAGCTACANACTGCGGCGCCGTGATCATTGGCCAGCGATACGC 180
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
9672R-1.in silico     121 GCCCTCTCCATCGGCGGAAGCTACA-ACTGCGGCGCCGTGATCATTGGCCAGCGATACGC 180


9672R-1.IR_full       181 CCTCACCGCCCTCTCTTGCGTCTGCTCCGACGGCAAGGATACCCCATGGGCTGCTGTTCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9672R-1.in silico     181 CCTCACCGCCCTCTCTTGCGTCTGCTCCGACGGCAAGGATACCCCATGGGCTGCTGTTCT 240


9672R-1.IR_full       241 GTTCGCCGTGACCGTAGGATCGGTGGATCTCTACAATGGCAAGCAGATTCGCGTGGAGGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9672R-1.in silico     241 GTTCGCCGTGACCGTAGGATCGGTGGATCTCTACAATGGCAAGCAGATTCGCGTGGAGGA 300


9672R-1.IR_full       301 GATCACCATTAACCCGAACTACAGCACTCTGAAGACCGGAANCGCCCTGCTCCGTCTGCA 360
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
9672R-1.in silico     301 GATCACCATTAACCCGAACTACAGCACTCTGAAGACCGGAATCGCCCTGCTCCGTCTGCA 360


9672R-1.IR_full       361 GGAGGAGATTACTTTCAGTGAGACAGTCAATGCCATTCCACTCTCCCAGGATCGTTCCGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
9672R-1.in silico     361 GGAGGAGATTACTTTCAGTGAGACAGTCAATGCCATTCCACTCTCCCAGGA-CGTTCCGC 420


9672R-1.IR_full        421 CATGGGCAGGCCAGGTGGAGGTCTCCGGNCTGGGGCCGCACCACCGAGTCCGAGGTGAA 479
                           |||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||
9672R-1.in silico      421 CATGGGCA-GCCAGGTGGAGGTCTCCGG-CTGGGGCCGCACCACCGAGTCCGAGGTGAA 479


9672R-1.IR_full       481 CATGCATCGCACCCTGCAAATAGGA 504
                          |||||||||||||||||||||||||
9672R-1.in silico     481 CATGCATCGCACCCTGCAAATAGGA 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  NM_132923.2  CG9672-RA (CG9672), mRNA 
0   NM_140824.1  CG11619-RA (CG11619), mRNA 
0   NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_206645.1  CG2252-RE, transcript variant E (fs(1)h), mRNA 
0   NM_206646.1  CG2252-RD, transcript variant D (fs(1)h), mRNA 
0   NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 
0   NM_167144.2  CG2252-RA, transcript variant A (fs(1)h), mRNA 
0   NM_168353.1  CG32048-RB, transcript variant B (CG32048), mRNA 
0   NM_057546.2  CG3090-RA, transcript variant A (Sox14), mRNA 
0   NM_134290.1  CG3090-RB, transcript variant B (Sox14), mRNA 
0   NM_169905.1  CG5191-RD, transcript variant D (CG5191), mRNA 
0   NM_169903.1  CG5191-RE, transcript variant E (CG5191), mRNA 
0   NM_142636.1  CG5191-RB, transcript variant B (CG5191), mRNA 
0   NM_169902.1  CG5191-RC, transcript variant C (CG5191), mRNA 
0   NM_169904.1  CG5191-RA, transcript variant A (CG5191), mRNA 
0   NM_057873.4  CG3057-RA, transcript variant A (colt), mRNA 
0   NM_205896.1  CG3057-RB, transcript variant B (colt), mRNA 
0   NM_205895.1  CG3057-RC, transcript variant C (colt), mRNA 
0   NM_205894.1  CG3057-RD, transcript variant D (colt), mRNA 
0   NM_167495.1  CG9911-RD, transcript variant D (CG9911), mRNA 
0   NM_167496.1  CG9911-RC, transcript variant C (CG9911), mRNA 
0   NM_132883.2  CG9911-RA, transcript variant A (CG9911), mRNA 
0   NM_167494.1  CG9911-RB, transcript variant B (CG9911), mRNA 
0   NM_135589.2  CG17104-RA (CG17104), mRNA 
0   NM_079676.2  CG6009-RA (P5cr), mRNA 
0   NM_166679.1  CG30163-RA (CG30163), mRNA 
0   NM_165283.1  CG17567-RC, transcript variant C (CG17567), mRNA 
0   NM_144330.1  CG17567-RA, transcript variant A (CG17567), mRNA 
0   NM_165284.1  CG17567-RD, transcript variant D (CG17567), mRNA 
0   NM_165282.1  CG17567-RB, transcript variant B (CG17567), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.