National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9653R-2 
 Symbol brk  Full Name brinker 
 CG No CG9653  Old CG No CG9653 
 Synonyms Brk, CG9653, ssg-1, brk 
 Accession No (Link to NCBI) NM_078514.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAACAGTTGAACGGATCGGGA 
 Primer Seq. 3'
aatctagaggtaccTGATGATGATGGGCGGCATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NAACAGTTGA ACGGATCGGG AGCTTTGAAT TTCAAGCGGC CCAAGGATTC TTCGGAGAAT 
0061 GCCACAAACA GCCACACAAA TAATGGCAAT TCTTCGGGCA GCCCCAAAAT GGGAAGTCGT 
0121 CGGATTTTCA CGCCCCACTT TAAGCTGCAA GTCCTCGAAT CATACAGGAA TGATAATGAT 
0181 TGCAAGGGCA ATCAACGGGC CACGGCCAGG AAATACAACA TTCACCGCCG GCAAATCCAA 
0241 AAATGGTTGC AATGCGAGTC AAATTTGCGA TCATCGGTGG CCAACAATCA GCAACAGCAG 
0301 CAGCAGCAGC AACAGCAACA GCAGCAACAA CAGCAGCAGC AGCAACTACT CCCACAGCAA 
0361 TCGGTATCGC CGACACCGGC GGTCNAAGGT GTTCCATCAG CTGAGCCATN CCGCTGGTGC 
0421 ACCAGTTGCA TCACCATTCA CGCCGCCGCG GTGGGGTCAT CATCATCATC ATGCCGCCCA 
0481 CCATCATGCC GCCCATCATC ATCA 
 in silico PCR Fragment
0001 GAACAGTTGA ACGGATCGGG AGCTTTGAAT TTCAAGCGGC CCAAGGATTC TTCGGAGAAT 
0061 GCCACAAACA GCCACACAAA TAATGGCAAT TCTTCGGGCA GCCCCAAAAT GGGAAGTCGT 
0121 CGGATTTTCA CGCCCCACTT TAAGCTGCAA GTCCTCGAAT CATACAGGAA TGATAATGAT 
0181 TGCAAGGGCA ATCAACGGGC CACGGCCAGG AAATACAACA TTCACCGCCG GCAAATCCAA 
0241 AAATGGTTGC AATGCGAGTC AAATTTGCGA TCATCGGTGG CCAACAATCA GCAACAGCAG 
0301 CAGCAGCAGC AACAGCAACA GCAGCAACAA CAGCAGCAGC AGCAACTACT CCCACAGCAA 
0361 TCGGTATCGC CGACACCGGC GGTC-AAGGT GTTCCATCAG CTGAGCCAT- CCGCTGGTGC 
0421 ACCAGTTGCA TCACCA-TCA CGCCGCCGCG GT-GGGTCAT CATCATCATC ATGCCGCCCA 
0481 CCATCATGCC GCCCATCATC ATCA 
 Assemble Data

9653R-2.IR_full        1   AACAGTTGAACGGATCGGGAGCTTTGAATTTCAAGCGGCCCAAGGATTCTTCGGAGAAT 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9653R-2.in silico      1   AACAGTTGAACGGATCGGGAGCTTTGAATTTCAAGCGGCCCAAGGATTCTTCGGAGAAT 59


9653R-2.IR_full       61  GCCACAAACAGCCACACAAATAATGGCAATTCTTCGGGCAGCCCCAAAATGGGAAGTCGT 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9653R-2.in silico     61  GCCACAAACAGCCACACAAATAATGGCAATTCTTCGGGCAGCCCCAAAATGGGAAGTCGT 119


9653R-2.IR_full       121 CGGATTTTCACGCCCCACTTTAAGCTGCAAGTCCTCGAATCATACAGGAATGATAATGAT 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9653R-2.in silico     121 CGGATTTTCACGCCCCACTTTAAGCTGCAAGTCCTCGAATCATACAGGAATGATAATGAT 179


9653R-2.IR_full       181 TGCAAGGGCAATCAACGGGCCACGGCCAGGAAATACAACATTCACCGCCGGCAAATCCAA 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9653R-2.in silico     181 TGCAAGGGCAATCAACGGGCCACGGCCAGGAAATACAACATTCACCGCCGGCAAATCCAA 239


9653R-2.IR_full       241 AAATGGTTGCAATGCGAGTCAAATTTGCGATCATCGGTGGCCAACAATCAGCAACAGCAG 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9653R-2.in silico     241 AAATGGTTGCAATGCGAGTCAAATTTGCGATCATCGGTGGCCAACAATCAGCAACAGCAG 299


9653R-2.IR_full       301 CAGCAGCAGCAACAGCAACAGCAGCAACAACAGCAGCAGCAGCAACTACTCCCACAGCAA 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9653R-2.in silico     301 CAGCAGCAGCAACAGCAACAGCAGCAACAACAGCAGCAGCAGCAACTACTCCCACAGCAA 359


9653R-2.IR_full       361 TCGGTATCGCCGACACCGGCGGTCNAAGGTGTTCCATCAGCTGAGCCATNCCGCTGGTGC 419
                          |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||
9653R-2.in silico     361 TCGGTATCGCCGACACCGGCGGTC-AAGGTGTTCCATCAGCTGAGCCAT-CCGCTGGTGC 419


9653R-2.IR_full       421 ACCAGTTGCATCACCATTCACGCCGCCGCGGTGGGGTCATCATCATCATCATGCCGCCCA 479
                          |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||
9653R-2.in silico     421 ACCAGTTGCATCACCA-TCACGCCGCCGCGGT-GGGTCATCATCATCATCATGCCGCCCA 479


9653R-2.IR_full       481 CCATCATGCCGCCCATCATCATCA 503
                          ||||||||||||||||||||||||
9653R-2.in silico     481 CCATCATGCCGCCCATCATCATCA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
103.94  501  128  448  865  NM_078514.2  CG9653-RA (brk), mRNA 
30.29   146  1067  2780  4126  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
30.29   146  1067  2780  4126  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
30.29   146  1067  2780  4126  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
10.58   51  188  559  957  NM_057497.3  CG5058-RD, transcript variant D (grh), mRNA 
10.58   51  188  559  957  NM_057496.3  CG5058-RC, transcript variant C (grh), mRNA 
10.37   50  246  605  868  NM_167000.1  CG32778-RA (CG32778), mRNA 
10.16   49  154  411  717  NM_166992.2  CG2904-RA (ec), mRNA 
9.95   48  411  1125  1930  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
9.95   48  411  1125  1930  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
9.95   48  251  738  1336  NM_139493.2  CG2083-RA (CG2083), mRNA 
9.54   46  290  837  1382  NM_079903.2  CG15319-RB (nej), mRNA 
8.71   42  316  926  1870  NM_168571.2  CG32133-RA (CG32133), mRNA 
8.5   41  175  486  1027  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
8.5   41  164  420  891  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
8.5   41  164  420  891  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
8.5   41  143  378  600  NM_057495.3  CG5058-RB, transcript variant B (grh), mRNA 
8.5   41  143  378  600  NM_057494.3  CG5058-RA, transcript variant A (grh), mRNA 
8.09   39  204  615  1047  NM_132246.2  CG10555-RA (CG10555), mRNA 
8.09   39  136  501  1131  NM_168179.1  CG32394-RA (CG32394), mRNA 
7.88   38  194  610  877  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
7.88   38  194  610  877  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
7.88   38  194  610  877  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
7.88   38  73  226  397  NM_136720.1  CG12912-RA (CG12912), mRNA 
7.67   37  225  545  927  NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
7.67   37  225  545  927  NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
7.67   37  210  661  1329  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
7.67   37  210  661  1328  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
7.67   37  210  661  1328  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
7.67   37  170  573  1167  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
+- 
DB
++ 
DC
++ 
DM
VM
+- 
VB
 
Caspase-3 signal
N
++  
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Dcompartment   Penetrance
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.