National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9650R-4 
 Symbol CG9650  Full Name CG9650 
 CG No CG9650  Old CG No CG9650 
 Synonyms CG9650 
 Accession No (Link to NCBI) NM_167123.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Dequéant ML, Fagegaltier D, Hu Y, Spirohn K, Simcox A, Hannon GJ, Perrimon N.
Discovery of progenitor cell signatures by time-series synexpression analysis during Drosophila embryonic cell immortalization.
Proc. Natl. Acad. Sci. U.S.A. (2015) 112(42) 12974-9 [ PubMed ID = 26438832 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGCCAATGGTCAGGTGGTGGGTGGCGTGGTCTCCGGTTCGGGTGAGCCACGTCCTCCATC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTCGAGCAGCAGTGGCAGCCAGAGGGGATCGGTGCCCCCGGCTGCCCTGCCACCACCATC 120

                          |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     121 TCTGAGCTCCCAGCAGCAGCAGCAACAGCAGCAGGCGG-TGCAGCAGCAGCAACAACAAG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCGCCCAGCAGCAACTCCAGTCCGCACAGCAGCAACAGCAGTCCCAGCAGCAATCGCAAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGCAACAGCAGATAACACCCGGTCTGGTTGGTGGAGCTGGTGGCTCCCTAAAATTGGAAC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCCAGCAGATGGATTTTTACTCGCAGCGATTGCGTCAGCTTGCGGGCACAACAAGCCCTG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAGCTGGCAGCACTGTTAACTCGAGCTCGCCGAGTCCTCGACAGAAGCAATCGCCGCATT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCGCGAGCCCCTCGCCCTCGCAGCAGCAGCAACAGCAACTGGCCACAATCCCGCGACCCC 480

9650R-4.IR_full       481 ATTCCCTCACTCCTCCCGAGA 501
                          ||||||||||||||||||||| silico     481 ATTCCCTCACTCCTCCCGAGA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  61  194  NM_132157.1  CG9650-RB, transcript variant B (CG9650), mRNA 
100   482  10  61  194  NM_167121.1  CG9650-RC, transcript variant C (CG9650), mRNA 
100   482  48  145  NM_167123.2  CG9650-RA, transcript variant A (CG9650), mRNA 
6.63   32  422  1017  2166  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
6.63   32  422  1017  2166  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
6.63   32  422  1017  2166  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
5.6   27  95  322  770  NM_079903.2  CG15319-RB (nej), mRNA 
5.18   25  77  208  555  NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
4.14   20  56  162  537  NM_132525.1  CG15740-RA (CG15740), mRNA 
4.14   20  52  185  360  NM_132004.2  CG4136-RA (CG4136), mRNA 
3.94   19  144  465  1099  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
3.94   19  144  465  1099  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
3.52   17  102  293  701  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
3.52   17  61  172  478  NM_142597.2  CG12254-RA (MED25), mRNA 
3.52   17  57  158  420  NM_079593.3  CG17228-RC, transcript variant C (pros), mRNA 
3.52   17  57  158  420  NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 
3.31   16  71  344  763  NM_139493.2  CG2083-RA (CG2083), mRNA 
3.31   16  56  223  443  NM_167000.1  CG32778-RA (CG32778), mRNA 
3.31   16  30  106  224  NM_057511.3  CG3936-RA (N), mRNA 
3.11   15  63  133  264  NM_167189.2  CG32705-RA (CG32705), mRNA 
3.11   15  56  188  388  NM_132126.1  CG3075-RA (CG3075), mRNA 
2.9   14  94  299  795  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
2.9   14  94  299  795  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
2.9   14  94  299  790  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
2.9   14  57  173  358  NM_001043134.1  CG7368-RB (CG7368), mRNA 
2.9   14  52  212  322  NM_206456.1  CG32466-RB, transcript variant B (rn), mRNA 
2.9   14  34  145  339  NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 
2.9   14  27  84  208  NM_176039.1  CG32970-RA (CG32970), mRNA 
2.9   14  26  115  360  NM_176542.1  CG7029-RA (CG7029), mRNA 
2.69   13  69  322  733  NM_078797.2  CG13109-RA (tai), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.