National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9650R-1 
 Symbol CG9650  Full Name CG9650 
 CG No CG9650  Old CG No CG9650 
 Synonyms CG9650 
 Accession No (Link to NCBI) NM_167123.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Dequéant ML, Fagegaltier D, Hu Y, Spirohn K, Simcox A, Hannon GJ, Perrimon N.
Discovery of progenitor cell signatures by time-series synexpression analysis during Drosophila embryonic cell immortalization.
Proc. Natl. Acad. Sci. U.S.A. (2015) 112(42) 12974-9 [ PubMed ID = 26438832 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCCAATGGTCAGGTGGTGGG 
 Primer Seq. 3'
aatctagaggtaccTCTCGGGAGGAGTGAGGGAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCCAATGGT CAGGTGGTGG GTGGCGTGGT CTCCGGTTCG GGTGAGCCAC GTCCTCCATC 
0061 GTCGAGCAGC AGTGGCAGCC AGAGGGGATC GGTGcCCCCG GCTGCCCTGC CACCACCATC 
0121 TCTGAGCTCC CAGCAGCAGC AGCAACAGCA GCAGGCGGNT GCAGCAGCAG CAACAACAAG 
0181 GCGCCCAGCA GCAACTCCAG TCCGCACAGC AGCAACAGCA GTCCCAGCAG CAATCGCAAC 
0241 AGCAACAGCA GATAACACCC GGTCTGGTTG GTGGAGCTGG TGGCTCCCTA AAATTGGAAC 
0301 CCCAGCAGAT GGATTTTTAC TCGCAGCGAT TGCGTCAGCT TGCGGGCACA ACAAGCCCTG 
0361 GAGCTGGCAG CACTGTTAAC TCGAGCTCGC CGAGTCCTCG ACAGAAGCAA TCGCCGCATT 
0421 TCGCGAGCCC CTCGCCCTCG CAGCAGCAGC AACAGCAACT GGCCACAATC CCGCGACCCC 
0481 ATTCCCTCAC TCCTCCCGAG A 
 in silico PCR Fragment
0001 TGCCAATGGT CAGGTGGTGG GTGGCGTGGT CTCCGGTTCG GGTGAGCCAC GTCCTCCATC 
0061 GTCGAGCAGC AGTGGCAGCC AGAGGGGATC GGTGCCCCCG GCTGCCCTGC CACCACCATC 
0121 TCTGAGCTCC CAGCAGCAGC AGCAACAGCA GCAGGCGG-T GCAGCAGCAG CAACAACAAG 
0181 GCGCCCAGCA GCAACTCCAG TCCGCACAGC AGCAACAGCA GTCCCAGCAG CAATCGCAAC 
0241 AGCAACAGCA GATAACACCC GGTCTGGTTG GTGGAGCTGG TGGCTCCCTA AAATTGGAAC 
0301 CCCAGCAGAT GGATTTTTAC TCGCAGCGAT TGCGTCAGCT TGCGGGCACA ACAAGCCCTG 
0361 GAGCTGGCAG CACTGTTAAC TCGAGCTCGC CGAGTCCTCG ACAGAAGCAA TCGCCGCATT 
0421 TCGCGAGCCC CTCGCCCTCG CAGCAGCAGC AACAGCAACT GGCCACAATC CCGCGACCCC 
0481 ATTCCCTCAC TCCTCCCGAG A 
 Assemble Data

9650R-1.IR_full       1   TGCCAATGGTCAGGTGGTGGGTGGCGTGGTCTCCGGTTCGGGTGAGCCACGTCCTCCATC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9650R-1.in silico     1   TGCCAATGGTCAGGTGGTGGGTGGCGTGGTCTCCGGTTCGGGTGAGCCACGTCCTCCATC 60


9650R-1.IR_full       61  GTCGAGCAGCAGTGGCAGCCAGAGGGGATCGGTGCCCCCGGCTGCCCTGCCACCACCATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9650R-1.in silico     61  GTCGAGCAGCAGTGGCAGCCAGAGGGGATCGGTGCCCCCGGCTGCCCTGCCACCACCATC 120


9650R-1.IR_full       121 TCTGAGCTCCCAGCAGCAGCAGCAACAGCAGCAGGCGGNTGCAGCAGCAGCAACAACAAG 180
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
9650R-1.in silico     121 TCTGAGCTCCCAGCAGCAGCAGCAACAGCAGCAGGCGG-TGCAGCAGCAGCAACAACAAG 180


9650R-1.IR_full       181 GCGCCCAGCAGCAACTCCAGTCCGCACAGCAGCAACAGCAGTCCCAGCAGCAATCGCAAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9650R-1.in silico     181 GCGCCCAGCAGCAACTCCAGTCCGCACAGCAGCAACAGCAGTCCCAGCAGCAATCGCAAC 240


9650R-1.IR_full       241 AGCAACAGCAGATAACACCCGGTCTGGTTGGTGGAGCTGGTGGCTCCCTAAAATTGGAAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9650R-1.in silico     241 AGCAACAGCAGATAACACCCGGTCTGGTTGGTGGAGCTGGTGGCTCCCTAAAATTGGAAC 300


9650R-1.IR_full       301 CCCAGCAGATGGATTTTTACTCGCAGCGATTGCGTCAGCTTGCGGGCACAACAAGCCCTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9650R-1.in silico     301 CCCAGCAGATGGATTTTTACTCGCAGCGATTGCGTCAGCTTGCGGGCACAACAAGCCCTG 360


9650R-1.IR_full       361 GAGCTGGCAGCACTGTTAACTCGAGCTCGCCGAGTCCTCGACAGAAGCAATCGCCGCATT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9650R-1.in silico     361 GAGCTGGCAGCACTGTTAACTCGAGCTCGCCGAGTCCTCGACAGAAGCAATCGCCGCATT 420


9650R-1.IR_full       421 TCGCGAGCCCCTCGCCCTCGCAGCAGCAGCAACAGCAACTGGCCACAATCCCGCGACCCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9650R-1.in silico     421 TCGCGAGCCCCTCGCCCTCGCAGCAGCAGCAACAGCAACTGGCCACAATCCCGCGACCCC 480


9650R-1.IR_full       481 ATTCCCTCACTCCTCCCGAGA 501
                          |||||||||||||||||||||
9650R-1.in silico     481 ATTCCCTCACTCCTCCCGAGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  61  194  NM_132157.1  CG9650-RB, transcript variant B (CG9650), mRNA 
100   482  10  61  194  NM_167121.1  CG9650-RC, transcript variant C (CG9650), mRNA 
100   482  48  145  NM_167123.2  CG9650-RA, transcript variant A (CG9650), mRNA 
6.63   32  422  1017  2166  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
6.63   32  422  1017  2166  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
6.63   32  422  1017  2166  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
5.6   27  95  322  770  NM_079903.2  CG15319-RB (nej), mRNA 
5.18   25  77  208  555  NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
4.14   20  56  162  537  NM_132525.1  CG15740-RA (CG15740), mRNA 
4.14   20  52  185  360  NM_132004.2  CG4136-RA (CG4136), mRNA 
3.94   19  144  465  1099  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
3.94   19  144  465  1099  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
3.52   17  102  293  701  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
3.52   17  61  172  478  NM_142597.2  CG12254-RA (MED25), mRNA 
3.52   17  57  158  420  NM_079593.3  CG17228-RC, transcript variant C (pros), mRNA 
3.52   17  57  158  420  NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 
3.31   16  71  344  763  NM_139493.2  CG2083-RA (CG2083), mRNA 
3.31   16  56  223  443  NM_167000.1  CG32778-RA (CG32778), mRNA 
3.31   16  30  106  224  NM_057511.3  CG3936-RA (N), mRNA 
3.11   15  63  133  264  NM_167189.2  CG32705-RA (CG32705), mRNA 
3.11   15  56  188  388  NM_132126.1  CG3075-RA (CG3075), mRNA 
2.9   14  94  299  795  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
2.9   14  94  299  795  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
2.9   14  94  299  790  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
2.9   14  57  173  358  NM_001043134.1  CG7368-RB (CG7368), mRNA 
2.9   14  52  212  322  NM_206456.1  CG32466-RB, transcript variant B (rn), mRNA 
2.9   14  34  145  339  NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 
2.9   14  27  84  208  NM_176039.1  CG32970-RA (CG32970), mRNA 
2.9   14  26  115  360  NM_176542.1  CG7029-RA (CG7029), mRNA 
2.69   13  69  322  733  NM_078797.2  CG13109-RA (tai), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
+  
VM
VB
 
Dcompartment   Penetrance
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.