National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9638R-3 
 Symbol Ada2b  Full Name Ada2b 
 CG No CG9638  Old CG No CG9638 
 Synonyms dAda2b, ada2b, dAda2S, CG9638, ADA2b, BcDNA:LD24527, Ada2S, Ada2b, dAda2B 
 Accession No (Link to NCBI) NM_141516.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Mahesh G, Rivas GBS, Caster C, Ost EB, Amunugama R, Jones R, Allen DL, Hardin PE.
Proteomic analysis of Drosophila CLOCK complexes identifies rhythmic interactions with SAGA and Tip60 complex component NIPPED-A.
Sci Rep (2020) 10(1) 17951 [ PubMed ID = 33087840 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGACCACAATCGCGGATTTA 
 Primer Seq. 3'
aatctagaggtaccTGGCCTCATCGGAGTTGATTT 
 Predicted Fragment Size
502 
 IR fragment full Seq
0001 ATGACCACAA TCGCGGATTT ATTCACAAAG TATAATTGCA CAAATTGCCA GGATGATATT 
0061 CAGGGCATTC GAGTGCACTG CGCGGAGTGC GAAAACTTCG ATTTGTGTCT GCAATGCTTT 
0121 GCCGCAGGTG CGGAGATCGG CGCCCATCAA AACAACCACT CCTACCAGTT CATGGACACC 
0181 GGCACTTCCA TATTGAGTGT ATTTCGTGGA AAGGGGGCGT GGACGGCACG AGAGGAAATC 
0241 CGCCTGTTGG ATGCAATCGA GCAGTACGGC TTTGGAAACT GGGAGGACAT TAGCAAGCAC 
0301 ATTGAGACGA AGTCAGCGGA GGATGCCAAA GAGGAGTACG TGAATAAGTT TGTAAATGGC 
0361 ACGATTGGAA GGGCCACTTG GACGCCGGCC CAGAGCCAGA AGACCCCGCC TTATCGATCA 
0421 CACTGGAGAC GACGACGCTG GTCCTCTGGG CACCAATGCT CTCTCTACCT TGCCTCCACT 
0481 GGGAAATCAA CTCCGATGAG GCCA 
 in silico PCR Fragment
0001 ATGACCACAA TCGCGGATTT ATTCACAAAG TATAATTGCA CAAATTGCCA GGATGATATT 
0061 CAGGGCATTC GAGTGCACTG CGCGGAGTGC GAAAACTTCG ATTTGTGTCT GCAATGCTTT 
0121 GCCGCAGGTG CGGAGATCGG CGCCCATCAA AACAACCACT CCTACCAGTT CATGGACACC 
0181 GGCACTTCCA TATTGAGTGT ATTTCGTGGA AAGGGGGCGT GGACGGCACG AGAGGAAATC 
0241 CGCCTGTTGG ATGCAATCGA GCAGTACGGC TTTGGAAACT GGGAGGACAT TAGCAAGCAC 
0301 ATTGAGACGA AGTCAGCGGA GGATGCCAAA GAGGAGTACG TGAATAAGTT TGTAAATGGC 
0361 ACGATTGGAA GGGCCACTTG GACGCCGGCC CAGAGCCAG- AGACCCCGCC TTATCGATCA 
0421 CACTGGAGAC GACGACGCTG GTCCTCTGGG CACCAATGCT CTCTCTACCT TGCCTCCACT 
0481 -GGAAATCAA CTCCGATGAG GCCA 
 Assemble Data

9638R-3.IR_full       1   ATGACCACAATCGCGGATTTATTCACAAAGTATAATTGCACAAATTGCCAGGATGATATT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9638R-3.in silico     1   ATGACCACAATCGCGGATTTATTCACAAAGTATAATTGCACAAATTGCCAGGATGATATT 60


9638R-3.IR_full       61  CAGGGCATTCGAGTGCACTGCGCGGAGTGCGAAAACTTCGATTTGTGTCTGCAATGCTTT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9638R-3.in silico     61  CAGGGCATTCGAGTGCACTGCGCGGAGTGCGAAAACTTCGATTTGTGTCTGCAATGCTTT 120


9638R-3.IR_full       121 GCCGCAGGTGCGGAGATCGGCGCCCATCAAAACAACCACTCCTACCAGTTCATGGACACC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9638R-3.in silico     121 GCCGCAGGTGCGGAGATCGGCGCCCATCAAAACAACCACTCCTACCAGTTCATGGACACC 180


9638R-3.IR_full       181 GGCACTTCCATATTGAGTGTATTTCGTGGAAAGGGGGCGTGGACGGCACGAGAGGAAATC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9638R-3.in silico     181 GGCACTTCCATATTGAGTGTATTTCGTGGAAAGGGGGCGTGGACGGCACGAGAGGAAATC 240


9638R-3.IR_full       241 CGCCTGTTGGATGCAATCGAGCAGTACGGCTTTGGAAACTGGGAGGACATTAGCAAGCAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9638R-3.in silico     241 CGCCTGTTGGATGCAATCGAGCAGTACGGCTTTGGAAACTGGGAGGACATTAGCAAGCAC 300


9638R-3.IR_full       301 ATTGAGACGAAGTCAGCGGAGGATGCCAAAGAGGAGTACGTGAATAAGTTTGTAAATGGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9638R-3.in silico     301 ATTGAGACGAAGTCAGCGGAGGATGCCAAAGAGGAGTACGTGAATAAGTTTGTAAATGGC 360


9638R-3.IR_full       361 ACGATTGGAAGGGCCACTTGGACGCCGGCCCAGAGCCAGAAGACCCCGCCTTATCGATCA 420
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
9638R-3.in silico     361 ACGATTGGAAGGGCCACTTGGACGCCGGCCCAGAGCCAG-AGACCCCGCCTTATCGATCA 420


9638R-3.IR_full       421 CACTGGAGACGACGACGCTGGTCCTCTGGGCACCAATGCTCTCTCTACCTTGCCTCCACT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9638R-3.in silico     421 CACTGGAGACGACGACGCTGGTCCTCTGGGCACCAATGCTCTCTCTACCTTGCCTCCACT 480


9638R-3.IR_full       481 GGGAAATCAACTCCGATGAGGCCA 504
                           |||||||||||||||||||||||
9638R-3.in silico     481 -GGAAATCAACTCCGATGAGGCCA 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   484  NM_141516.2  CG9638-RA, transcript variant A (Ada2b), mRNA 
100   484  NM_001031980.1  CG9638-RB, transcript variant B (Ada2b), mRNA 
0   15  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_078714.5  CG9559-RA, transcript variant A (fog), mRNA 
0   NM_001038771.2  CG9559-RB, transcript variant B (fog), mRNA 
0   NM_132429.2  CG2202-RA (CG2202), mRNA 
0   NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
0   NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
0   NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
0   NM_079077.2  CG9441-RC, transcript variant C (Pu), mRNA 
0   NM_166431.2  CG9441-RA, transcript variant A (Pu), mRNA 
0   NM_141040.1  CG7752-RA (Z4), mRNA 
0   NM_138233.1  CG9094-RB, transcript variant B (CG9094), mRNA 
0   NM_167853.1  CG9094-RA, transcript variant A (CG9094), mRNA 
0   NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
0   NM_167520.2  CG32575-RB, transcript variant B (hang), mRNA 
0   NM_167521.2  CG32575-RA, transcript variant A (hang), mRNA 
0   NM_132109.1  CG3198-RA (CG3198), mRNA 
0   NM_170179.1  CG31121-RA, transcript variant A (CG31121), mRNA 
0   NM_170180.1  CG31121-RB, transcript variant B (CG31121), mRNA 
0   NM_078864.2  CG13281-RA (Cas), mRNA 
0   NM_167965.1  CG32296-RA (Mrtf), mRNA 
0   NM_165868.1  CG8857-RC, transcript variant C (RpS11), mRNA 
0   NM_136903.3  CG8857-RA, transcript variant A (RpS11), mRNA 
0   NM_165869.2  CG8857-RB, transcript variant B (RpS11), mRNA 
0   NM_130557.2  CG14786-RA (CG14786), mRNA 
0   NM_137879.2  CG9825-RA (CG9825), mRNA 
0   NM_167852.1  CG9097-RB, transcript variant B (bab1), mRNA 
0   NM_170096.3  CG13602-RA, transcript variant A (CG13602), mRNA 
0   NM_001043284.1  CG13602-RB, transcript variant B (CG13602), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.