National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9623R-2 
 Symbol if  Full Name inflated 
 CG No CG9623  Old CG No CG9623 
 Synonyms CG9623, alphaPS2, PS2, alpha[[PS2]], PSalpha2, CT27194, aPS2, PS2alpha, in, inf, alpha[[PS2(ms8)]], PS 2, if, alphaPS2C 
 Accession No (Link to NCBI) NM_078654.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Xie X, Gilbert M, Petley-Ragan L, Auld VJ.
Loss of focal adhesions in glia disrupts both glial and photoreceptor axon migration in the Drosophila visual system.
Development (2014) 141(15) 3072-83 [ PubMed ID = 25053436 ] [ RRC reference ]

Nonaka S, Nagaosa K, Mori T, Shiratsuchi A, Nakanishi Y.
Integrin αPS3/βν-mediated phagocytosis of apoptotic cells and bacteria in Drosophila.
J Biol Chem. (2013) 288(15) 10374-80 [ PubMed ID = 23426364 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Perkins AD, Ellis SJ, Asghari P, Shamsian A, Moore ED, Tanentzapf G.
Integrin-mediated adhesion maintains sarcomeric integrity.
Dev. Biol. (2010) 338(1) 15-27 [ PubMed ID = 19879257 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCCATAACGAGCCTGATTCTG 
 Primer Seq. 3'
aatctagaggtaccACCTCGTAGAACTCCTCGAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCCATAACGA GCCTGATTCT GCTCCTGATC GCCATGTCCG CCCATGGTTA CAACATCGAC 
0061 CTGCCCAGCT ACGTCCGTTT CCGGCAGTCC AGCAACTCGA TGTTCGGATT CAGCATTGCG 
0121 ATGCACAAGG GTCGCAGTGG ATTCTACGGC AATCAGAACA ATGTCAGTTT GATTGTCGGA 
0181 GCACCCAAAT TCGACACCTC CCGCTATCAA CAGGGCGTGA CCGAGGCAGG AGGCGTTTTC 
0241 AAATGCAGCC TCAACGACGA CGACTGCAAA TTGGTGCCAT TCGACTCCAA AGGCAACAAT 
0301 CGCAATGTGG ACAAGGAGGT CGTGGACAGG AAATCCTATC AATGGTTGGG CGCCACTGTG 
0361 GCCACCGGTC GGGATAGCGA CTTGGTTGTG GCCTGTGCAC CGCGCTATGT CTTCCACACG 
0421 ATGACGCCAT CGAGGGCgTT CCGCATTGAT CCCGTGGGCA CCTGCTTCAC CTCGCACAAC 
0481 TTCGAGGAGT TCTACGAGGT  
 in silico PCR Fragment
0001 CCCATAACGA GCCTGATTCT GCTCCTGATC GCCATGTCCG CCCATGGTTA CAACATCGAC 
0061 CTGCCCAGCT ACGTCCGTTT CCGGCAGTCC AGCAACTCGA TGTTCGGATT CAGCATTGCG 
0121 ATGCACAAGG GTCGCAGTGG ATTCTACGGC AATCAGAATA ATGTCAGTTT GATTGTCGGA 
0181 GCACCCAAAT TCGACACCTC CCGCTATCAA CAGGGCGTGA CCGAGGCAGG AGGCGTTTTC 
0241 AAATGCAGCC TCAACGACGA CGACTGCAAA TTGGTGCCAT TCGACTCCAA AGGCAACAAT 
0301 CGCAATGTGG ACAAGGAGGT CGTGGACAGG AAATCCTATC AATGGTTGGG CGCCACTGTG 
0361 GCAACCGGTC GGGATAGCGA CTTGGTTGTG GCCTGTGCAC CGCGCTATGT CTTCCACACG 
0421 ATGACGCCAT CGAGGGCGTT CCGCATTGAT CCCGTGGGCA CCTGCTTCAC CTCGCACAAC 
0481 TTCGAGGAGT TCTACGAGGT  
 Assemble Data

9623R-2.IR_full       1   CCCATAACGAGCCTGATTCTGCTCCTGATCGCCATGTCCGCCCATGGTTACAACATCGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9623R-2.in silico     1   CCCATAACGAGCCTGATTCTGCTCCTGATCGCCATGTCCGCCCATGGTTACAACATCGAC 60


9623R-2.IR_full       61  CTGCCCAGCTACGTCCGTTTCCGGCAGTCCAGCAACTCGATGTTCGGATTCAGCATTGCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9623R-2.in silico     61  CTGCCCAGCTACGTCCGTTTCCGGCAGTCCAGCAACTCGATGTTCGGATTCAGCATTGCG 120


9623R-2.IR_full       121 ATGCACAAGGGTCGCAGTGGATTCTACGGCAATCAGAACAATGTCAGTTTGATTGTCGGA 180
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
9623R-2.in silico     121 ATGCACAAGGGTCGCAGTGGATTCTACGGCAATCAGAATAATGTCAGTTTGATTGTCGGA 180


9623R-2.IR_full       181 GCACCCAAATTCGACACCTCCCGCTATCAACAGGGCGTGACCGAGGCAGGAGGCGTTTTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9623R-2.in silico     181 GCACCCAAATTCGACACCTCCCGCTATCAACAGGGCGTGACCGAGGCAGGAGGCGTTTTC 240


9623R-2.IR_full       241 AAATGCAGCCTCAACGACGACGACTGCAAATTGGTGCCATTCGACTCCAAAGGCAACAAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9623R-2.in silico     241 AAATGCAGCCTCAACGACGACGACTGCAAATTGGTGCCATTCGACTCCAAAGGCAACAAT 300


9623R-2.IR_full       301 CGCAATGTGGACAAGGAGGTCGTGGACAGGAAATCCTATCAATGGTTGGGCGCCACTGTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9623R-2.in silico     301 CGCAATGTGGACAAGGAGGTCGTGGACAGGAAATCCTATCAATGGTTGGGCGCCACTGTG 360


9623R-2.IR_full       361 GCCACCGGTCGGGATAGCGACTTGGTTGTGGCCTGTGCACCGCGCTATGTCTTCCACACG 420
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9623R-2.in silico     361 GCAACCGGTCGGGATAGCGACTTGGTTGTGGCCTGTGCACCGCGCTATGTCTTCCACACG 420


9623R-2.IR_full       421 ATGACGCCATCGAGGGCGTTCCGCATTGATCCCGTGGGCACCTGCTTCACCTCGCACAAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9623R-2.in silico     421 ATGACGCCATCGAGGGCGTTCCGCATTGATCCCGTGGGCACCTGCTTCACCTCGCACAAC 480


9623R-2.IR_full       481 TTCGAGGAGTTCTACGAGGT 500
                          ||||||||||||||||||||
9623R-2.in silico     481 TTCGAGGAGTTCTACGAGGT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078654.2  CG9623-RB, transcript variant B (if), mRNA 
0.41   NM_057349.4  CG31349-RB, transcript variant B (pyd), mRNA 
0.41   NM_169245.2  CG31349-RA, transcript variant A (pyd), mRNA 
0.41   NM_169246.2  CG31349-RC, transcript variant C (pyd), mRNA 
0   NM_168368.1  CG32044-RA (CG32044), mRNA 
0   NM_141669.2  CG8362-RA (nmdyn-D7), mRNA 
0   NM_136094.1  CG10493-RA (CG10493), mRNA 
0   NM_130688.2  CG14423-RA (CG14423), mRNA 
0   NM_142928.2  CG10375-RA (CG10375), mRNA 
0   NM_140027.1  CG5144-RA (CG5144), mRNA 
0   NM_135753.2  CG9934-RA (CG9934), mRNA 
0   NM_165011.2  CG31764-RB, transcript variant B (vir-1), mRNA 
0   NM_165010.2  CG31764-RA, transcript variant A (vir-1), mRNA 
0   NM_205966.1  CG31764-RC, transcript variant C (vir-1), mRNA 
0   NM_138243.2  CG9128-RA (Sac1), mRNA 
0   NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_166666.1  CG3394-RA, transcript variant A (CG3394), mRNA 
0   NM_138062.2  CG3394-RB, transcript variant B (CG3394), mRNA 
0   NM_143245.2  CG14247-RA (CG14247), mRNA 
0   NM_057531.3  CG6863-RA, transcript variant A (tok), mRNA 
0   NM_170168.1  CG6863-RB, transcript variant B (tok), mRNA 
0   NM_135232.1  CG17375-RA (CG17375), mRNA 
0   NM_057497.3  CG5058-RD, transcript variant D (grh), mRNA 
0   NM_057496.3  CG5058-RC, transcript variant C (grh), mRNA 
0   NM_166252.1  CG5058-RG, transcript variant G (grh), mRNA 
0   NM_141922.1  CG4115-RA (CG4115), mRNA 
0   NR_002497.1  CG4115-RA (CG4115), mRNA, miscRNA 
0   12  NM_205987.1  CG32972-RA, transcript variant A (CG32972), mRNA 
0   NM_176378.1  CG33056-RA, transcript variant A (CG33056), mRNA 
0   NM_206310.1  CG18177-RA, transcript variant A (CG18177), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.