National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9623R-2 
 Symbol if  Full Name inflated 
 CG No CG9623  Old CG No CG9623 
 Synonyms CG9623, alphaPS2, PS2, alpha[[PS2]], PSalpha2, CT27194, aPS2, PS2alpha, in, inf, alpha[[PS2(ms8)]], PS 2, if, alphaPS2C 
 Accession No (Link to NCBI) NM_078654.2 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Xie X, Gilbert M, Petley-Ragan L, Auld VJ.
Loss of focal adhesions in glia disrupts both glial and photoreceptor axon migration in the Drosophila visual system.
Development (2014) 141(15) 3072-83 [ PubMed ID = 25053436 ] [ RRC reference ]

Dai J, Ma M, Feng Z, Pastor-Pareja JC.
Inter-adipocyte Adhesion and Signaling by Collagen IV Intercellular Concentrations in Drosophila.
Curr. Biol. (2017) 27(18) 2729-2740.e4 [ PubMed ID = 28867208 ] [ RRC reference ]

Xie X, Auld VJ.
Integrins are necessary for the development and maintenance of the glial layers in the Drosophila peripheral nerve.
Development (2011) 138(17) 3813-22 [ PubMed ID = 21828098 ] [ RRC reference ]

Perkins AD, Ellis SJ, Asghari P, Shamsian A, Moore ED, Tanentzapf G.
Integrin-mediated adhesion maintains sarcomeric integrity.
Dev. Biol. (2010) 338(1) 15-27 [ PubMed ID = 19879257 ] [ RRC reference ]

Nonaka S, Nagaosa K, Mori T, Shiratsuchi A, Nakanishi Y.
Integrin αPS3/βν-mediated phagocytosis of apoptotic cells and bacteria in Drosophila.
J. Biol. Chem. (2013) 288(15) 10374-80 [ PubMed ID = 23426364 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCCATAACGAGCCTGATTCTGCTCCTGATCGCCATGTCCGCCCATGGTTACAACATCGAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CTGCCCAGCTACGTCCGTTTCCGGCAGTCCAGCAACTCGATGTTCGGATTCAGCATTGCG 120

                          |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     121 ATGCACAAGGGTCGCAGTGGATTCTACGGCAATCAGAATAATGTCAGTTTGATTGTCGGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCACCCAAATTCGACACCTCCCGCTATCAACAGGGCGTGACCGAGGCAGGAGGCGTTTTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAATGCAGCCTCAACGACGACGACTGCAAATTGGTGCCATTCGACTCCAAAGGCAACAAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCAATGTGGACAAGGAGGTCGTGGACAGGAAATCCTATCAATGGTTGGGCGCCACTGTG 360

                          || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCAACCGGTCGGGATAGCGACTTGGTTGTGGCCTGTGCACCGCGCTATGTCTTCCACACG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATGACGCCATCGAGGGCGTTCCGCATTGATCCCGTGGGCACCTGCTTCACCTCGCACAAC 480

9623R-2.IR_full       481 TTCGAGGAGTTCTACGAGGT 500
                          |||||||||||||||||||| silico     481 TTCGAGGAGTTCTACGAGGT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078654.2  CG9623-RB, transcript variant B (if), mRNA 
0.41   NM_057349.4  CG31349-RB, transcript variant B (pyd), mRNA 
0.41   NM_169245.2  CG31349-RA, transcript variant A (pyd), mRNA 
0.41   NM_169246.2  CG31349-RC, transcript variant C (pyd), mRNA 
0   NM_168368.1  CG32044-RA (CG32044), mRNA 
0   NM_141669.2  CG8362-RA (nmdyn-D7), mRNA 
0   NM_136094.1  CG10493-RA (CG10493), mRNA 
0   NM_130688.2  CG14423-RA (CG14423), mRNA 
0   NM_142928.2  CG10375-RA (CG10375), mRNA 
0   NM_140027.1  CG5144-RA (CG5144), mRNA 
0   NM_135753.2  CG9934-RA (CG9934), mRNA 
0   NM_165011.2  CG31764-RB, transcript variant B (vir-1), mRNA 
0   NM_165010.2  CG31764-RA, transcript variant A (vir-1), mRNA 
0   NM_205966.1  CG31764-RC, transcript variant C (vir-1), mRNA 
0   NM_138243.2  CG9128-RA (Sac1), mRNA 
0   NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_166666.1  CG3394-RA, transcript variant A (CG3394), mRNA 
0   NM_138062.2  CG3394-RB, transcript variant B (CG3394), mRNA 
0   NM_143245.2  CG14247-RA (CG14247), mRNA 
0   NM_057531.3  CG6863-RA, transcript variant A (tok), mRNA 
0   NM_170168.1  CG6863-RB, transcript variant B (tok), mRNA 
0   NM_135232.1  CG17375-RA (CG17375), mRNA 
0   NM_057497.3  CG5058-RD, transcript variant D (grh), mRNA 
0   NM_057496.3  CG5058-RC, transcript variant C (grh), mRNA 
0   NM_166252.1  CG5058-RG, transcript variant G (grh), mRNA 
0   NM_141922.1  CG4115-RA (CG4115), mRNA 
0   NR_002497.1  CG4115-RA (CG4115), mRNA, miscRNA 
0   12  NM_205987.1  CG32972-RA, transcript variant A (CG32972), mRNA 
0   NM_176378.1  CG33056-RA, transcript variant A (CG33056), mRNA 
0   NM_206310.1  CG18177-RA, transcript variant A (CG18177), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.