National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9623R-1 
 Symbol if  Full Name inflated 
 CG No CG9623  Old CG No CG9623 
 Synonyms CG9623, alphaPS2, PS2, alpha[[PS2]], PSalpha2, CT27194, aPS2, PS2alpha, in, inf, alpha[[PS2(ms8)]], PS 2, if, alphaPS2C 
 Accession No (Link to NCBI) NM_078654.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Perkins AD, Ellis SJ, Asghari P, Shamsian A, Moore ED, Tanentzapf G.
Integrin-mediated adhesion maintains sarcomeric integrity.
Dev Biol (2010) 338(1) 15-27 [ PubMed ID = 19879257 ] [ RRC reference ]

Xie X, Auld VJ.
Integrins are necessary for the development and maintenance of the glial layers in the Drosophila peripheral nerve.
Development (2011) 138(17) 3813-22 [ PubMed ID = 21828098 ] [ RRC reference ]

Nonaka S, Nagaosa K, Mori T, Shiratsuchi A, Nakanishi Y.
Integrin αPS3/βν-mediated phagocytosis of apoptotic cells and bacteria in Drosophila.
J Biol Chem (2013) 288(15) 10374-80 [ PubMed ID = 23426364 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCCATAACGAGCCTGATTCTGCTCCTGATCGCCATGTCCGCCCATGGTTACAACATCGAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CTGCCCAGCTACGTCCGTTTCCGGCAGTCCAGCAACTCGATGTTCGGATTCAGCATTGCG 120

                          |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     121 ATGCACAAGGGTCGCAGTGGATTCTACGGCAATCAGAATAATGTCAGTTTGATTGTCGGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCACCCAAATTCGACACCTCCCGCTATCAACAGGGCGTGACCGAGGCAGGAGGCGTTTTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAATGCAGCCTCAACGACGACGACTGCAAATTGGTGCCATTCGACTCCAAAGGCAACAAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCAATGTGGACAAGGAGGTCGTGGACAGGAAATCCTATCAATGGTTGGGCGCCACTGTG 360

                          || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCAACCGGTCGGGATAGCGACTTGGTTGTGGCCTGTGCACCGCGCTATGTCTTCCACACG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATGACGCCATCGAGGGCGTTCCGCATTGATCCCGTGGGCACCTGCTTCACCTCGCACAAC 480

9623R-1.IR_full       481 TTCGAGGAGTTCTACGAGGT 500
                          |||||||||||||||||||| silico     481 TTCGAGGAGTTCTACGAGGT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078654.2  CG9623-RB, transcript variant B (if), mRNA 
0.41   NM_057349.4  CG31349-RB, transcript variant B (pyd), mRNA 
0.41   NM_169245.2  CG31349-RA, transcript variant A (pyd), mRNA 
0.41   NM_169246.2  CG31349-RC, transcript variant C (pyd), mRNA 
0   NM_168368.1  CG32044-RA (CG32044), mRNA 
0   NM_141669.2  CG8362-RA (nmdyn-D7), mRNA 
0   NM_136094.1  CG10493-RA (CG10493), mRNA 
0   NM_130688.2  CG14423-RA (CG14423), mRNA 
0   NM_142928.2  CG10375-RA (CG10375), mRNA 
0   NM_140027.1  CG5144-RA (CG5144), mRNA 
0   NM_135753.2  CG9934-RA (CG9934), mRNA 
0   NM_165011.2  CG31764-RB, transcript variant B (vir-1), mRNA 
0   NM_165010.2  CG31764-RA, transcript variant A (vir-1), mRNA 
0   NM_205966.1  CG31764-RC, transcript variant C (vir-1), mRNA 
0   NM_138243.2  CG9128-RA (Sac1), mRNA 
0   NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_166666.1  CG3394-RA, transcript variant A (CG3394), mRNA 
0   NM_138062.2  CG3394-RB, transcript variant B (CG3394), mRNA 
0   NM_143245.2  CG14247-RA (CG14247), mRNA 
0   NM_057531.3  CG6863-RA, transcript variant A (tok), mRNA 
0   NM_170168.1  CG6863-RB, transcript variant B (tok), mRNA 
0   NM_135232.1  CG17375-RA (CG17375), mRNA 
0   NM_057497.3  CG5058-RD, transcript variant D (grh), mRNA 
0   NM_057496.3  CG5058-RC, transcript variant C (grh), mRNA 
0   NM_166252.1  CG5058-RG, transcript variant G (grh), mRNA 
0   NM_141922.1  CG4115-RA (CG4115), mRNA 
0   NR_002497.1  CG4115-RA (CG4115), mRNA, miscRNA 
0   12  NM_205987.1  CG32972-RA, transcript variant A (CG32972), mRNA 
0   NM_176378.1  CG33056-RA, transcript variant A (CG33056), mRNA 
0   NM_206310.1  CG18177-RA, transcript variant A (CG18177), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.