National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9614R-3 
 Symbol pip  Full Name pipe 
 CG No CG9614  Old CG No CG9614 
 Synonyms pipe, pipe-ST2, CG9614, pip 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCTCTACGGACGTCTATATC 
 Primer Seq. 3'
aatctagaggtaccTATCGCGAAAGTGAAACTTGG 
 Predicted Fragment Size
520 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

9614R-3.IR full       1   AGCTCTACGGACGTCTATATCTCTAAGTCTTCGAATCGTGAATCGGAACTCAAGTGAACC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-3.in silico     1   AGCTCTACGGACGTCTATATCTCTAAGTCTTCGAATCGTGAATCGGAACTCAAGTGAACC 60


9614R-3.IR full       61  CAAGTGCTGACCGGAAAATTCTTTCGGCCAAGAAAGGTCTTCGAGAACTAAGATCTCAAG 120
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-3.in silico     61  CAAGTGCCGACCGGAAAATTCTTTCGGCCAAGAAAGGTCTTCGAGAACTAAGATCTCAAG 120


9614R-3.IR full       121 CGATTGTGTTTTTTGTGTAATTGACATTGGATGTCTCTGAACGCCGAGCGATCGTACAAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-3.in silico     121 CGATTGTGTTTTTTGTGTAATTGACATTGGATGTCTCTGAACGCCGAGCGATCGTACAAA 180


9614R-3.IR full       181 ATGAAACTGCGCGATGTGGAAAATGCCTTCAAATACCGGCGCATACCGTATCCCAAGCGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-3.in silico     181 ATGAAACTGCGCGATGTGGAAAATGCCTTCAAATACCGGCGCATACCGTATCCCAAGCGT 240


9614R-3.IR full       241 TCCGTCGAGCTGATCGCCCTGCTGGCTATTTCGTGCACCTTCTTCCTGTTCATGCACACC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-3.in silico     241 TCCGTCGAGCTGATCGCCCTGCTGGCTATTTCGTGCACCTTCTTCCTGTTCATGCACACC 300


9614R-3.IR full       301 AACAAACTGAACAGTCGCCTCAAGGAGATGGAGGTGAAGCTGCAGCCATCGGAGTTTTCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-3.in silico     301 AACAAACTGAACAGTCGCCTCAAGGAGATGGAGGTGAAGCTGCAGCCATCGGAGTTTTCG 360


9614R-3.IR full       361 GCCCTCGGTCTAACGGGCAACCACATCAGCGGACACGATGCGGGCAAGCACGATGACATC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-3.in silico     361 GCCCTCGGTCTAACGGGCAACCACATCAGCGGACACGATGCGGGCAAGCACGATGACATC 420


9614R-3.IR full       421 AACACCCCTGCACGGCACCTACCAATATCTGAAGAGCACTGGCCAGNTGTNNNNNNTNAA 480
                          ||||||| |||||||||||||||||||||||||||||||||||||| |||      | ||
9614R-3.in silico     421 AACACCC-TGCACGGCACCTACCAATATCTGAAGAGCACTGGCCAGCTGTGGCGATTAAA 480


9614R-3.IR full        NN481 GNNNNNTCTNAANAANACNNNNNNNNNNNNNNNNGANN 518
                             |     ||| || || ||                ||  
9614R-3.in silico      TC481 GAAATTTCTAAATAACACCAAGTTTCACTTTCGCGATA 518

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  502  NM_168793.1  pipe CG9614-RC, transcript variant C (pip), mRNA 
89.64  450  NM_176356.1  pipe CG9614-RF, transcript variant F (pip), mRNA 
89.44  449  NM_176351.1  pipe CG9614-RJ, transcript variant J (pip), mRNA 
89.44  449  NM_176354.1  pipe CG9614-RG, transcript variant G (pip), mRNA 
89.44  449  NM_176359.1  pipe CG9614-RK, transcript variant K (pip), mRNA 
89.44  449  NM_176352.1  pipe CG9614-RI, transcript variant I (pip), mRNA 
89.04  447  NM_079434.2  pipe CG9614-RA, transcript variant A (pip), mRNA 
89.04  447  NM_176353.1  pipe CG9614-RH, transcript variant H (pip), mRNA 
89.04  447  NM_176355.1  pipe CG9614-RD, transcript variant D (pip), mRNA 
89.04  447  NM_176358.1  pipe CG9614-RL, transcript variant L (pip), mRNA 
89.04  447  NM_176357.1  pipe CG9614-RE, transcript variant E (pip), mRNA 
0.19  NM_080487.2  Cyclin-dependent kinase 8 CG10572-RA (Cdk8), mRNA 
NM_169125.1  Odorant-binding protein 83ef CG31557-RA (Obp83ef), mRNA 
11  NM_169549.1  falafel CG9351-RC, transcript variant C (flfl), mRNA 
11  NM_142047.1  falafel CG9351-RA, transcript variant A (flfl), mRNA 
11  NM_169548.1  falafel CG9351-RB, transcript variant B (flfl), mRNA 
NM_079086.2  quaking related 58E-2 CG5821-RA (qkr58E-2), mRNA 
NM_168237.1  PAR-domain protein 1 CG17888-RD, transcript variant D (Pdp1), mRNA 
NM_166536.1  Vps20 CG4071-RA, transcript variant A (Vps20), mRNA 
NM_137842.2  Vps20 CG4071-RB, transcript variant B (Vps20), mRNA 
NM_138254.2  CG9153-RB, transcript variant B (CG9153), mRNA 
NM_167868.1  CG9153-RA, transcript variant A (CG9153), mRNA 
NM_143705.2  Spt6 CG12225-RA (Spt6), mRNA 
NM_176176.1  Kinesin-73 CG8183-RB, transcript variant B (Khc-73), mRNA 
NM_132507.1  CG2247-RA (CG2247), mRNA 
NM_143344.2  Glycoprotein 93 CG5520-RA (Gp93), mRNA 
NM_132744.1  CG14411-RA, transcript variant A (CG14411), mRNA 
NM_206713.1  CG14411-RB, transcript variant B (CG14411), mRNA 
NM_166591.1  CG30416-RA (CG30416), mRNA 
NM_144252.1  CG17776-RA (CG17776), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.