National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9614R-2 
 Symbol pip  Full Name pipe 
 CG No CG9614  Old CG No CG9614 
 Synonyms pipe, pipe-ST2, CG9614, pip 
 Accession No (Link to NCBI)  
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCTCTACGGACGTCTATATC 
 Primer Seq. 3'
aatctagaggtaccTATCGCGAAAGTGAAACTTGG 
 Predicted Fragment Size
520 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

9614R-2.IR full       1   AGCTCTACGGACGTCTATATCTCTAAGTCTTCGAATCGTGAATCGGAACTCAAGTGAACC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-2.in silico     1   AGCTCTACGGACGTCTATATCTCTAAGTCTTCGAATCGTGAATCGGAACTCAAGTGAACC 60


9614R-2.IR full       61  CAAGTGCTGACCGGAAAATTCTTTCGGCCAAGAAAGGTCTTCGAGAACTAAGATCTCAAG 120
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-2.in silico     61  CAAGTGCCGACCGGAAAATTCTTTCGGCCAAGAAAGGTCTTCGAGAACTAAGATCTCAAG 120


9614R-2.IR full       121 CGATTGTGTTTTTTGTGTAATTGACATTGGATGTCTCTGAACGCCGAGCGATCGTACAAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-2.in silico     121 CGATTGTGTTTTTTGTGTAATTGACATTGGATGTCTCTGAACGCCGAGCGATCGTACAAA 180


9614R-2.IR full       181 ATGAAACTGCGCGATGTGGAAAATGCCTTCAAATACCGGCGCATACCGTATCCCAAGCGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-2.in silico     181 ATGAAACTGCGCGATGTGGAAAATGCCTTCAAATACCGGCGCATACCGTATCCCAAGCGT 240


9614R-2.IR full       241 TCCGTCGAGCTGATCGCCCTGCTGGCTATTTCGTGCACCTTCTTCCTGTTCATGCACACC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-2.in silico     241 TCCGTCGAGCTGATCGCCCTGCTGGCTATTTCGTGCACCTTCTTCCTGTTCATGCACACC 300


9614R-2.IR full       301 AACAAACTGAACAGTCGCCTCAAGGAGATGGAGGTGAAGCTGCAGCCATCGGAGTTTTCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-2.in silico     301 AACAAACTGAACAGTCGCCTCAAGGAGATGGAGGTGAAGCTGCAGCCATCGGAGTTTTCG 360


9614R-2.IR full       361 GCCCTCGGTCTAACGGGCAACCACATCAGCGGACACGATGCGGGCAAGCACGATGACATC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9614R-2.in silico     361 GCCCTCGGTCTAACGGGCAACCACATCAGCGGACACGATGCGGGCAAGCACGATGACATC 420


9614R-2.IR full       421 AACACCCCTGCACGGCACCTACCAATATCTGAAGAGCACTGGCCAGNTGTNNNNNNTNAA 480
                          ||||||| |||||||||||||||||||||||||||||||||||||| |||      | ||
9614R-2.in silico     421 AACACCC-TGCACGGCACCTACCAATATCTGAAGAGCACTGGCCAGCTGTGGCGATTAAA 480


9614R-2.IR full        NN481 GNNNNNTCTNAANAANACNNNNNNNNNNNNNNNNGANN 518
                             |     ||| || || ||                ||  
9614R-2.in silico      TC481 GAAATTTCTAAATAACACCAAGTTTCACTTTCGCGATA 518

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  502  NM_168793.1  pipe CG9614-RC, transcript variant C (pip), mRNA 
89.64  450  NM_176356.1  pipe CG9614-RF, transcript variant F (pip), mRNA 
89.44  449  NM_176351.1  pipe CG9614-RJ, transcript variant J (pip), mRNA 
89.44  449  NM_176354.1  pipe CG9614-RG, transcript variant G (pip), mRNA 
89.44  449  NM_176359.1  pipe CG9614-RK, transcript variant K (pip), mRNA 
89.44  449  NM_176352.1  pipe CG9614-RI, transcript variant I (pip), mRNA 
89.04  447  NM_079434.2  pipe CG9614-RA, transcript variant A (pip), mRNA 
89.04  447  NM_176353.1  pipe CG9614-RH, transcript variant H (pip), mRNA 
89.04  447  NM_176355.1  pipe CG9614-RD, transcript variant D (pip), mRNA 
89.04  447  NM_176358.1  pipe CG9614-RL, transcript variant L (pip), mRNA 
89.04  447  NM_176357.1  pipe CG9614-RE, transcript variant E (pip), mRNA 
0.19  NM_080487.2  Cyclin-dependent kinase 8 CG10572-RA (Cdk8), mRNA 
NM_169125.1  Odorant-binding protein 83ef CG31557-RA (Obp83ef), mRNA 
11  NM_169549.1  falafel CG9351-RC, transcript variant C (flfl), mRNA 
11  NM_142047.1  falafel CG9351-RA, transcript variant A (flfl), mRNA 
11  NM_169548.1  falafel CG9351-RB, transcript variant B (flfl), mRNA 
NM_079086.2  quaking related 58E-2 CG5821-RA (qkr58E-2), mRNA 
NM_168237.1  PAR-domain protein 1 CG17888-RD, transcript variant D (Pdp1), mRNA 
NM_166536.1  Vps20 CG4071-RA, transcript variant A (Vps20), mRNA 
NM_137842.2  Vps20 CG4071-RB, transcript variant B (Vps20), mRNA 
NM_138254.2  CG9153-RB, transcript variant B (CG9153), mRNA 
NM_167868.1  CG9153-RA, transcript variant A (CG9153), mRNA 
NM_143705.2  Spt6 CG12225-RA (Spt6), mRNA 
NM_176176.1  Kinesin-73 CG8183-RB, transcript variant B (Khc-73), mRNA 
NM_132507.1  CG2247-RA (CG2247), mRNA 
NM_143344.2  Glycoprotein 93 CG5520-RA (Gp93), mRNA 
NM_132744.1  CG14411-RA, transcript variant A (CG14411), mRNA 
NM_206713.1  CG14411-RB, transcript variant B (CG14411), mRNA 
NM_166591.1  CG30416-RA (CG30416), mRNA 
NM_144252.1  CG17776-RA (CG17776), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.