National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9564R-2 
 Symbol Try29F  Full Name Trypsin 29F 
 CG No CG9564  Old CG No CG9564 
 Synonyms SP106, CG9564, try29F.2, try29F, Try29F 
 Accession No (Link to NCBI) NM_078794.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGAGCATTGGATTGACCGGCA 
 Primer Seq. 3'
aatctagaggtaccGTTTCCCCAGCCGGAAACCAG 
 Predicted Fragment Size
494 
 IR fragment full Seq
0001 CGAGCATTGG ATTGACCGGC ATGGCAAAGA CGATTCTTCA TCTGTTTATC GGCGGGATTC 
0061 TCCTGGTAAA TCTGAGCTTA GGAGCCACTG TAAGGCGCCC ACGCCTGGAT GGACGCATTG 
0121 TGGGCgGCCA GGTNGGCTAA CATAAAGGAC ATTCCCTATC AGGTTTCCCT GCAGCGTAGC 
0181 TATCACTTCT GTGGTGGCTC TTTAATCGCT CAGGGTTGGG TGCTCACAGC TGCCCACTGC 
0241 ACTGAAGGAT CTGCGATACT CTTATCCAAA GTTCGTATTG GCTCCTCGCG GACTTCTGTG 
0301 GGCGGTCAAT TGGTGGGGAT CAAGCGAGTT CATCGACATC CCAAATTCGA TGCCTACACC 
0361 ATTGACTTTG ACTTTTCGCT GCTCGAACTG GAGGAATATA GTGCCAAGAA CGTGACGCAG 
0421 GCTTTCGTTG GGCTTCCCGA ACAGGATGCG GACATTGCCG ATGGTACACC GGTCCTGGTT 
0481 TCCGGCTGGG GAAAC 
 in silico PCR Fragment
0001 CGAGCATTGG ATTGACCGGC ATGGCAAAGA CGATTCTTCA TCTGTTTATC GGCGGGATTC 
0061 TCCTGGTAAA TCTGAGCTTA GGAGCCACTG TAAGGCGCCC ACGCCTGGAT GGACGCATTG 
0121 TGGGCGGCCA GGT-GGCTAA CATAAAGGAC ATTCCCTATC AGGTTTCCCT GCAGCGTAGC 
0181 TATCACTTCT GTGGTGGCTC TTTAATCGCT CAGGGTTGGG TGCTCACAGC TGCCCACTGC 
0241 ACTGAAGGAT CTGCGATACT CTTATCCAAA GTTCGTATTG GCTCCTCGCG GACTTCTGTG 
0301 GGCGGTCAAT TGGTGGGGAT CAAGCGAGTT CATCGACATC CCAAATTCGA TGCCTACACC 
0361 ATTGACTTTG ACTTTTCGCT GCTCGAACTG GAGGAATATA GTGCCAAGAA CGTGACGCAG 
0421 GCTTTCGTTG GGCTTCCCGA ACAGGATGCG GACATTGCCG ATGGTACACC GGTCCTGGTT 
0481 TCCGGCTGGG GAAAC 
 Assemble Data

9564R-2.IR_full       1   CGAGCATTGGATTGACCGGCATGGCAAAGACGATTCTTCATCTGTTTATCGGCGGGATTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9564R-2.in silico     1   CGAGCATTGGATTGACCGGCATGGCAAAGACGATTCTTCATCTGTTTATCGGCGGGATTC 60


9564R-2.IR_full       61  TCCTGGTAAATCTGAGCTTAGGAGCCACTGTAAGGCGCCCACGCCTGGATGGACGCATTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9564R-2.in silico     61  TCCTGGTAAATCTGAGCTTAGGAGCCACTGTAAGGCGCCCACGCCTGGATGGACGCATTG 120


9564R-2.IR_full       121 TGGGCGGCCAGGTNGGCTAACATAAAGGACATTCCCTATCAGGTTTCCCTGCAGCGTAGC 180
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
9564R-2.in silico     121 TGGGCGGCCAGGT-GGCTAACATAAAGGACATTCCCTATCAGGTTTCCCTGCAGCGTAGC 180


9564R-2.IR_full       181 TATCACTTCTGTGGTGGCTCTTTAATCGCTCAGGGTTGGGTGCTCACAGCTGCCCACTGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9564R-2.in silico     181 TATCACTTCTGTGGTGGCTCTTTAATCGCTCAGGGTTGGGTGCTCACAGCTGCCCACTGC 240


9564R-2.IR_full       241 ACTGAAGGATCTGCGATACTCTTATCCAAAGTTCGTATTGGCTCCTCGCGGACTTCTGTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9564R-2.in silico     241 ACTGAAGGATCTGCGATACTCTTATCCAAAGTTCGTATTGGCTCCTCGCGGACTTCTGTG 300


9564R-2.IR_full       301 GGCGGTCAATTGGTGGGGATCAAGCGAGTTCATCGACATCCCAAATTCGATGCCTACACC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9564R-2.in silico     301 GGCGGTCAATTGGTGGGGATCAAGCGAGTTCATCGACATCCCAAATTCGATGCCTACACC 360


9564R-2.IR_full       361 ATTGACTTTGACTTTTCGCTGCTCGAACTGGAGGAATATAGTGCCAAGAACGTGACGCAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9564R-2.in silico     361 ATTGACTTTGACTTTTCGCTGCTCGAACTGGAGGAATATAGTGCCAAGAACGTGACGCAG 420


9564R-2.IR_full       421 GCTTTCGTTGGGCTTCCCGAACAGGATGCGGACATTGCCGATGGTACACCGGTCCTGGTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9564R-2.in silico     421 GCTTTCGTTGGGCTTCCCGAACAGGATGCGGACATTGCCGATGGTACACCGGTCCTGGTT 480


9564R-2.IR_full       481 TCCGGCTGGGGAAAC 495
                          |||||||||||||||
9564R-2.in silico     481 TCCGGCTGGGGAAAC 495

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   476  NM_078794.2  CG9564-RA (Try29F), mRNA 
0.84   NM_206195.1  CG33226-RA (CG33226), mRNA 
0.21   NM_168237.1  CG17888-RD, transcript variant D (Pdp1), mRNA 
0.21   NM_168238.1  CG17888-RH, transcript variant H (Pdp1), mRNA 
0   NM_079831.2  CG31039-RA (Jon99Ci), mRNA 
0   16  NM_078969.3  CG12385-RA (thetaTry), mRNA 
0   NM_168003.2  CG32270-RA, transcript variant A (CG32270), mRNA 
0   NM_139531.3  CG32269-RA, transcript variant A (CG32269), mRNA 
0   NM_140580.1  CG5414-RA (CG5414), mRNA 
0   NM_132375.1  CG2972-RA (CG2972), mRNA 
0   NM_135038.1  CG8869-RA (Jon25Bii), mRNA 
0   NM_139609.1  CG15003-RA (Teh4), mRNA 
0   NM_142344.1  CG4053-RA (CG4053), mRNA 
0   12  NM_137303.1  CG5197-RA (CG5197), mRNA 
0   NM_141483.2  CG2993-RA (CG2993), mRNA 
0   NM_078649.2  CG9842-RA (Pp2B-14D), mRNA 
0   NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
0   NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
0   NM_165189.1  CG17927-RB, transcript variant B (Mhc), mRNA 
0   NM_165192.1  CG17927-RM, transcript variant M (Mhc), mRNA 
0   NM_165191.1  CG17927-RL, transcript variant L (Mhc), mRNA 
0   NM_165190.1  CG17927-RK, transcript variant K (Mhc), mRNA 
0   NM_078863.4  CG17927-RH, transcript variant H (Mhc), mRNA 
0   NM_165188.1  CG17927-RI, transcript variant I (Mhc), mRNA 
0   NM_165187.1  CG17927-RA, transcript variant A (Mhc), mRNA 
0   NM_165186.1  CG17927-RD, transcript variant D (Mhc), mRNA 
0   NM_165185.1  CG17927-RF, transcript variant F (Mhc), mRNA 
0   NM_165184.1  CG17927-RJ, transcript variant J (Mhc), mRNA 
0   NM_165183.1  CG17927-RE, transcript variant E (Mhc), mRNA 
0   NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.