National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9553R-3 
 Symbol chic  Full Name chickadee 
 CG No CG9553  Old CG No CG9553 
 Synonyms profilin, sand, Chi, Chic, CG9553, chi, l(2)27/7, D88, chic 
 Accession No (Link to NCBI) NM_057668.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
[Please submit your publication]
Fairchild MJ, Smendziuk CM, Tanentzapf G.
A somatic permeability barrier around the germline is essential for Drosophila spermatogenesis.
Development (2015) 142(2) 268-81 [ PubMed ID = 25503408 ] [ RRC reference ]

Matsukawa K, Hashimoto T, Matsumoto T, Ihara R, Chihara T, Miura M, Wakabayashi T, Iwatsubo T.
Familial Amyotrophic Lateral Sclerosis-linked Mutations in Profilin 1 Exacerbate TDP-43-induced Degeneration in the Retina of Drosophila melanogaster through an Increase in the Cytoplasmic Localization of TDP-43.
J. Biol. Chem. (2016) 291(45) 23464-23476 [ PubMed ID = 27634045 ] [ RRC reference ]

Brock AR, Wang Y, Berger S, Renkawitz-Pohl R, Han VC, Wu Y, Galko MJ.
Transcriptional regulation of Profilin during wound closure in Drosophila larvae.
J. Cell. Sci. (2012) 125(Pt 23) 5667-76 [ PubMed ID = 22976306 ] [ RRC reference ]

Tsai CR, Anderson AE, Burra S, Jo J, Galko MJ.
Yorkie regulates epidermal wound healing in Drosophila larvae independently of cell proliferation and apoptosis.
Dev. Biol. (2017) 427(1) 61-71 [ PubMed ID = 28514643 ] [ RRC reference ]

Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGCTGGCAAGATTATGTGGACAACCAACTCCTGGCCTCGCAGTGCGTGACCAAGGCGTGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATCGCCGGCCACGACGGCAACATTTGGGCGCAGTCCAGTGGCTTTGAGGTGACAAAAGAG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAGCTCTCCAAACTGATCAGCGGCTTTGACCAGCAGGACGGTCTCACCAGCAACGGCGTG 180

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     181 ACACTCGCCGGCCAGCGGTACATTTACCTTTCCGGCACAGACCGCGTGGTGCGCGCC-AA 240

                          ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     241 GCTCGGCCGGAGCGG-AGTGCACTGCATGAAGACAACACAAGCCGTGATCGTTTCCATCT 300

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACGAGGATCCCGTTCAGCCCCAGCAGGCCGCTTCCGTGGTAGAGAAACTTGGAGA 355

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   335  NM_057668.4  CG9553-RA, transcript variant A (chic), mRNA 
100   335  NM_205913.1  CG9553-RD, transcript variant D (chic), mRNA 
100   335  NM_164667.2  CG9553-RC, transcript variant C (chic), mRNA 
100   335  NM_134304.2  CG9553-RB, transcript variant B (chic), mRNA 
0   NM_133126.1  CG7556-RA (CG7556), mRNA 
0   NM_142691.1  CG5798-RA (CG5798), mRNA 
0   NM_164562.1  CG3964-RB, transcript variant B (CG3964), mRNA 
0   NM_134966.2  CG3964-RA, transcript variant A (CG3964), mRNA 
0   NM_136242.2  CG12050-RA (CG12050), mRNA 
0   NM_135649.1  CG4738-RA (CG4738), mRNA 
0   NM_143476.2  CG7802-RA, transcript variant A (CG7802), mRNA 
0   NM_206583.1  CG7802-RB, transcript variant B (CG7802), mRNA 
0   NM_143345.2  CG4951-RA (CG4951), mRNA 
0   11  NM_142215.2  CG5205-RA (CG5205), mRNA 
0   NM_132507.1  CG2247-RA (CG2247), mRNA 
0   NM_169844.1  CG31149-RA (CG31149), mRNA 
0   NM_206724.1  CG8497-RB, transcript variant B (Rhp), mRNA 
0   NM_078613.3  CG8497-RA, transcript variant A (Rhp), mRNA 
0   NM_136502.2  CG14762-RA (CG14762), mRNA 
0   NM_132788.2  CG9114-RA (CG9114), mRNA 
0   NM_132789.2  CG6170-RA, transcript variant A (HDAC6), mRNA 
0   NM_136608.2  CG8777-RA (CG8777), mRNA 
0   NM_170267.1  CG6154-RB, transcript variant B (CG6154), mRNA 
0   NM_143214.1  CG6154-RA, transcript variant A (CG6154), mRNA 
0   NM_169172.1  CG1070-RB, transcript variant B (Alh), mRNA 
0   NM_169171.1  CG1070-RD, transcript variant D (Alh), mRNA 
0   NM_079526.2  CG1070-RA, transcript variant A (Alh), mRNA 
0   NM_169170.1  CG1070-RC, transcript variant C (Alh), mRNA 
0   NM_165103.2  CG3506-RA (vas), mRNA 
0   NM_206294.1  CG33275-RA, transcript variant A (CG33275), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.