National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9553R-3 
 Symbol chic  Full Name chickadee 
 CG No CG9553  Old CG No CG9553 
 Synonyms profilin, sand, Chi, Chic, CG9553, chi, l(2)27/7, D88, chic 
 Accession No (Link to NCBI) NM_057668.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
[Please submit your publication]
Matsukawa K, Hashimoto T, Matsumoto T, Ihara R, Chihara T, Miura M, Wakabayashi T, Iwatsubo T.
Familial ALS-linked Mutations in Profilin 1 Exacerbate TDP-43-induced Degeneration in the Retina of Drosophila Melanogaster through an Increase in the Cytoplasmic Localization of TDP-43.
J. Biol. Chem. (2016) [ PubMed ID = 27634045 ] [ RRC reference ]

Fairchild MJ, Smendziuk CM, Tanentzapf G.
A somatic permeability barrier around the germline is essential for Drosophila spermatogenesis.
Development (2015) 142(2) 268-81 [ PubMed ID = 25503408 ] [ RRC reference ]

Brock AR, Wang Y, Berger S, Renkawitz-Pohl R, Han VC, Wu Y, Galko MJ.
Transcriptional regulation of Profilin during wound closure in Drosophila larvae.
J. Cell. Sci. (2012) 125(Pt 23) 5667-76 [ PubMed ID = 22976306 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGCTGGCAAGATTATGTGGACAACCAACTCCTGGCCTCGCAGTGCGTGACCAAGGCGTGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATCGCCGGCCACGACGGCAACATTTGGGCGCAGTCCAGTGGCTTTGAGGTGACAAAAGAG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAGCTCTCCAAACTGATCAGCGGCTTTGACCAGCAGGACGGTCTCACCAGCAACGGCGTG 180

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     181 ACACTCGCCGGCCAGCGGTACATTTACCTTTCCGGCACAGACCGCGTGGTGCGCGCC-AA 240

                          ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     241 GCTCGGCCGGAGCGG-AGTGCACTGCATGAAGACAACACAAGCCGTGATCGTTTCCATCT 300

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACGAGGATCCCGTTCAGCCCCAGCAGGCCGCTTCCGTGGTAGAGAAACTTGGAGA 355

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   335  NM_057668.4  CG9553-RA, transcript variant A (chic), mRNA 
100   335  NM_205913.1  CG9553-RD, transcript variant D (chic), mRNA 
100   335  NM_164667.2  CG9553-RC, transcript variant C (chic), mRNA 
100   335  NM_134304.2  CG9553-RB, transcript variant B (chic), mRNA 
0   NM_133126.1  CG7556-RA (CG7556), mRNA 
0   NM_142691.1  CG5798-RA (CG5798), mRNA 
0   NM_164562.1  CG3964-RB, transcript variant B (CG3964), mRNA 
0   NM_134966.2  CG3964-RA, transcript variant A (CG3964), mRNA 
0   NM_136242.2  CG12050-RA (CG12050), mRNA 
0   NM_135649.1  CG4738-RA (CG4738), mRNA 
0   NM_143476.2  CG7802-RA, transcript variant A (CG7802), mRNA 
0   NM_206583.1  CG7802-RB, transcript variant B (CG7802), mRNA 
0   NM_143345.2  CG4951-RA (CG4951), mRNA 
0   11  NM_142215.2  CG5205-RA (CG5205), mRNA 
0   NM_132507.1  CG2247-RA (CG2247), mRNA 
0   NM_169844.1  CG31149-RA (CG31149), mRNA 
0   NM_206724.1  CG8497-RB, transcript variant B (Rhp), mRNA 
0   NM_078613.3  CG8497-RA, transcript variant A (Rhp), mRNA 
0   NM_136502.2  CG14762-RA (CG14762), mRNA 
0   NM_132788.2  CG9114-RA (CG9114), mRNA 
0   NM_132789.2  CG6170-RA, transcript variant A (HDAC6), mRNA 
0   NM_136608.2  CG8777-RA (CG8777), mRNA 
0   NM_170267.1  CG6154-RB, transcript variant B (CG6154), mRNA 
0   NM_143214.1  CG6154-RA, transcript variant A (CG6154), mRNA 
0   NM_169172.1  CG1070-RB, transcript variant B (Alh), mRNA 
0   NM_169171.1  CG1070-RD, transcript variant D (Alh), mRNA 
0   NM_079526.2  CG1070-RA, transcript variant A (Alh), mRNA 
0   NM_169170.1  CG1070-RC, transcript variant C (Alh), mRNA 
0   NM_165103.2  CG3506-RA (vas), mRNA 
0   NM_206294.1  CG33275-RA, transcript variant A (CG33275), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.