National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9550R-2 
 Symbol CG9550  Full Name CG9550 
 CG No CG9550  Old CG No CG9550 
 Synonyms CG9550 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGCTGGGATCCCGAGACCAT 
 Primer Seq. 3'
aatctagaggtaccGCCCCAATATCGTCCACCATC 
 Predicted Fragment Size
501 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

9550R-2.IR full       1   GTGCTGGGATCCCGAGACCATGNCCGCCGTCTGCAAGCTGTACCCATTCATCAACATGGC 60
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
9550R-2.in silico     1   GTGCTGGGATCCCGAGACCATGGCCGCCGTCTGCAAGCTGTACCCATTCATCAACATGGC 60


9550R-2.IR full       61  GGTGTACAACTTGCGGCTGAATCTTTTGGCCTCCCTTCTGGAACGCAAAGACCTAAATCT 120
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
9550R-2.in silico     61  GGTGTACAACTTGCGGCTGAATCTTTTGGCTTCCCTTCTGGAACGCAAAGACCTAAATCT 120


9550R-2.IR full       121 GAACATCATGCTGCTTGTTCGCGATCCTCGGGGCACCATATATTCCCGAATGAATAACAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9550R-2.in silico     121 GAACATCATGCTGCTTGTTCGCGATCCTCGGGGCACCATATATTCCCGAATGAATAACAA 180


9550R-2.IR full       181 GTGGTGTTCGGATGAGAGGGATTGCGAGGCACAGGAACTTTGCGGCGACATGGTCAGTGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9550R-2.in silico     181 GTGGTGTTCGGATGAGAGGGATTGCGAGGCACAGGAACTTTGCGGCGACATGGTCAGTGA 240


9550R-2.IR full       241 TTATCAAATGGTCGAGACCCTCACCCAAGCCTATCCACAGCGTTTTAGCATTATACGTTA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9550R-2.in silico     241 TTATCAAATGGTCGAGACCCTCACCCAAGCCTATCCACAGCGTTTTAGCATTATACGTTA 300


9550R-2.IR full       301 TGAGGACTTGTTCCTACAGCCCGATGAGAGTATCAAACAAGTATTCGACTTTTACGGATT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9550R-2.in silico     301 TGAGGACTTGTTCCTACAGCCCGATGAGAGTATCAAACAAGTATTCGACTTTTACGGATT 360


9550R-2.IR full       361 GCCCTTGGAACGAAACAGGACCAGGATTCAGAAAATGCATCCGCGCAGTGGCTACTTTGT 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
9550R-2.in silico     361 GCCCTTGGAACGAAACAGGACCAGGATTCAGAAAATGCATCCGCGCAGTGGCTACTTTTT 420


9550R-2.IR full       421 TCAGTCCTCCCGCTGGAAGGAGCTCTCCAGCCAGTCCGCCTTCGAGTGGATAAGCGAAAT 480
                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
9550R-2.in silico     421 TCAGTCCTCCCGCTGGAAGGAGCTTTCCAGCCAGTCCGCCTTCGAGTGGATAAGCGAAAT 480


9550R-2.IR full       481 GATGGTGGACGATATTGGGGC 501
                          |||||||||||||||||||||
9550R-2.in silico     481 GATGGTGGACGATATTGGGGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  483  NM_135198.1  CG9550-RA (CG9550), mRNA 
NM_170046.1  Gustatory receptor 94a CG31280-RA (Gr94a), mRNA 
NM_137200.2  CG30467-RA (CG30467), mRNA 
NM_165160.1  dachshund CG4952-RA, transcript variant A (dac), mRNA 
NM_165159.1  dachshund CG4952-RC, transcript variant C (dac), mRNA 
NM_001014486.1  dachshund CG4952-RG, transcript variant G (dac), mRNA 
NM_165162.1  dachshund CG4952-RB, transcript variant B (dac), mRNA 
NM_165161.1  dachshund CG4952-RD, transcript variant D (dac), mRNA 
NM_001014487.1  dachshund CG4952-RF, transcript variant F (dac), mRNA 
NM_165163.1  dachshund CG4952-RE, transcript variant E (dac), mRNA 
NM_169866.1  CG6231-RD, transcript variant D (CG6231), mRNA 
NM_170528.2  CG31012-RD, transcript variant D (CG31012), mRNA 
NM_170526.2  CG31012-RC, transcript variant C (CG31012), mRNA 
NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
NM_140354.1  CG14119-RA (CG14119), mRNA 
NM_079016.3  Multi drug resistance 50 CG8523-RA (Mdr50), mRNA 
NM_164438.1  Gustatory receptor 22e CG31936-RA (Gr22e), mRNA 
NM_143048.1  CG11089-RA (CG11089), mRNA 
NM_079578.2  jumeau CG4029-RA (jumu), mRNA 
NM_140155.2  tonalli CG7958-RA, transcript variant A (tna), mRNA 
NM_168422.1  tonalli CG7958-RB, transcript variant B (tna), mRNA 
NM_135175.2  CG9505-RA (CG9505), mRNA 
NM_079279.2  Ubiquitin C-terminal hydrolase CG3431-RA (Uch-L3), mRNA 
NM_080709.3  bride of sevenless CG8285-RA (boss), mRNA 
NM_135277.2  CG12789-RB, transcript variant B (CG12789), mRNA 
NM_164752.2  CG12789-RA, transcript variant A (CG12789), mRNA 
NM_167405.1  CG18157-RA (CG18157), mRNA 
NM_136856.1  Transport and Golgi organization 3 CG12444-RB, transcript variant B (Tango3), mRNA 
NM_165848.1  Transport and Golgi organization 3 CG12444-RA, transcript variant A (Tango3), mRNA 
NM_165451.2  maleless CG11680-RC, transcript variant C (mle), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.