National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9533R-2 
 Symbol rut  Full Name rutabaga 
 CG No CG9533  Old CG No CG9533 
 Synonyms CG9533, AC, Ac12F, unnamed, EP1603, rut 
 Accession No (Link to NCBI) NM_078601.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Murmu MS, Martin JR.
Interaction between cAMP and intracellular Ca(2+)-signaling pathways during odor-perception and adaptation in Drosophila.
Biochim. Biophys. Acta (2016) 1863(9) 2156-74 [ PubMed ID = 27212269 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGATCATGCCGTGAAGGCGA 
 Primer Seq. 3'
aatctagaggtaccACTTATGTGCACCGAGGGCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGATCATGC CGTGAAGGCG ACGCGCGGCC GCCCGTTGAA TACGCTGCGC TTCGAGAACG 
0061 ATGAGCTGGA ATGCCTCTAC CAGCGGTATA CGCTCAAGCT GCAGCGCTTC TCGGTGCTGG 
0121 GCGTGGTGGC TCTGGTCTTC GTCCTCTGCG GCGTGATGGC GGCCCTTTCG CTGACCTTCA 
0181 ACAACGCGGC CACCTTTCAC AACATCTTCA ATGCGATCGT TTGTGGACTG TTTGCCGTGG 
0241 TGCTGGTGCT GCTGCAGTGT TCCGTGATCA AGGACCACCA CCTGCCCACA TTGTGCTACG 
0301 GAATCCTGCT ATTCACGGCC AGCATCTGTG TGGTGTCGAT GCCCACATTG GGCAGCGTGT 
0361 TCCCGGTGGA CACCAAGGAG GTGATGGCCG AGGGCGTCTG GCAGATCGTG TTCGTGGTCT 
0421 TCCTCGCTTA CGCCATGATG CCGCTGCAGA TTTGGGAGGC GGTGGcCTTT GGcATCGNCC 
0481 TGCCCTCGGT GCACATAAGT  
 in silico PCR Fragment
0001 TGGATCATGC CGTGAAGGCG ACGCGCGGCC GCCCGTTGAA TACGCTGCGC TTCGAGAACG 
0061 ATGAGCTGGA ATGCCTCTAC CAGCGGTATA CGCTCAAGCT GCAGCGCTTC TCGGTGCTGG 
0121 GCGTGGTGGC TCTGGTCTTC GTCCTCTGCG GCGTGATGGC GGCCCTTTCG CTGACCTTCA 
0181 ACAACGCGGC CACCTTTCAC AACATCTTCA ATGCGATCGT TTGTGGACTG TTTGCCGTGG 
0241 TGCTGGTGCT GCTGCAGTGT TCCGTGATCA AGGACCACCA CCTGCCCACA TTGTGCTACG 
0301 GAATCCTGCT ATTCACGGCC AGCATCTGTG TGGTGTCGAT GCCCACATTG GGCAGCGTGT 
0361 TCCCGGTGGA CACCAAGGAG GTGATGGCCG AGGGCGTCTG GCAGATCGTG TTCGTGGTCT 
0421 TCCTCGCTTA CGCCATGATG CCGCTGCAGA TTTGGGAGGC GGTGGCCTTT GGCATCGCCC 
0481 TGCCCTCGGT GCACATAAGT  
 Assemble Data

9533R-2.IR_full       1   TGGATCATGCCGTGAAGGCGACGCGCGGCCGCCCGTTGAATACGCTGCGCTTCGAGAACG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9533R-2.in silico     1   TGGATCATGCCGTGAAGGCGACGCGCGGCCGCCCGTTGAATACGCTGCGCTTCGAGAACG 60


9533R-2.IR_full       61  ATGAGCTGGAATGCCTCTACCAGCGGTATACGCTCAAGCTGCAGCGCTTCTCGGTGCTGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9533R-2.in silico     61  ATGAGCTGGAATGCCTCTACCAGCGGTATACGCTCAAGCTGCAGCGCTTCTCGGTGCTGG 120


9533R-2.IR_full       121 GCGTGGTGGCTCTGGTCTTCGTCCTCTGCGGCGTGATGGCGGCCCTTTCGCTGACCTTCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9533R-2.in silico     121 GCGTGGTGGCTCTGGTCTTCGTCCTCTGCGGCGTGATGGCGGCCCTTTCGCTGACCTTCA 180


9533R-2.IR_full       181 ACAACGCGGCCACCTTTCACAACATCTTCAATGCGATCGTTTGTGGACTGTTTGCCGTGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9533R-2.in silico     181 ACAACGCGGCCACCTTTCACAACATCTTCAATGCGATCGTTTGTGGACTGTTTGCCGTGG 240


9533R-2.IR_full       241 TGCTGGTGCTGCTGCAGTGTTCCGTGATCAAGGACCACCACCTGCCCACATTGTGCTACG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9533R-2.in silico     241 TGCTGGTGCTGCTGCAGTGTTCCGTGATCAAGGACCACCACCTGCCCACATTGTGCTACG 300


9533R-2.IR_full       301 GAATCCTGCTATTCACGGCCAGCATCTGTGTGGTGTCGATGCCCACATTGGGCAGCGTGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9533R-2.in silico     301 GAATCCTGCTATTCACGGCCAGCATCTGTGTGGTGTCGATGCCCACATTGGGCAGCGTGT 360


9533R-2.IR_full       361 TCCCGGTGGACACCAAGGAGGTGATGGCCGAGGGCGTCTGGCAGATCGTGTTCGTGGTCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9533R-2.in silico     361 TCCCGGTGGACACCAAGGAGGTGATGGCCGAGGGCGTCTGGCAGATCGTGTTCGTGGTCT 420


9533R-2.IR_full       421 TCCTCGCTTACGCCATGATGCCGCTGCAGATTTGGGAGGCGGTGGCCTTTGGCATCGNCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
9533R-2.in silico     421 TCCTCGCTTACGCCATGATGCCGCTGCAGATTTGGGAGGCGGTGGCCTTTGGCATCGCCC 480


9533R-2.IR_full       481 TGCCCTCGGTGCACATAAGT 500
                          ||||||||||||||||||||
9533R-2.in silico     481 TGCCCTCGGTGCACATAAGT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  38  NM_078601.2  CG9533-RA (rut), mRNA 
1.03   10  NM_139854.1  CG8583-RA (sec63), mRNA 
0.62   45  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0.62   45  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0.41   16  NM_132908.2  CG4453-RA (Nup153), mRNA 
0   16  51  NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
0   76  NM_079903.2  CG15319-RB (nej), mRNA 
0   NM_136859.2  CG8991-RA (Sobp), mRNA 
0   NM_170430.2  CG31037-RA (ca), mRNA 
0   NM_206241.1  CG1275-RD, transcript variant D (CG1275), mRNA 
0   NM_167942.1  CG1275-RA, transcript variant A (CG1275), mRNA 
0   NM_167941.1  CG1275-RC, transcript variant C (CG1275), mRNA 
0   NM_139446.2  CG1275-RB, transcript variant B (CG1275), mRNA 
0   21  NM_168102.1  CG32239-RA (Gef64C), mRNA 
0   19  NM_130578.2  CG32809-RD, transcript variant D (CG32809), mRNA 
0   14  30  NM_167647.2  CG12199-RB, transcript variant B (kek5), mRNA 
0   14  30  NM_133154.2  CG12199-RA, transcript variant A (kek5), mRNA 
0   12  37  NM_080120.2  CG14560-RA (msopa), mRNA 
0   35  NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   18  NM_001014734.1  CG1522-RH, transcript variant H (cac), mRNA 
0   18  NM_078578.2  CG1522-RA, transcript variant A (cac), mRNA 
0   18  NM_206696.1  CG1522-RC, transcript variant C (cac), mRNA 
0   18  NM_001014733.1  CG1522-RI, transcript variant I (cac), mRNA 
0   18  NM_206694.1  CG1522-RE, transcript variant E (cac), mRNA 
0   18  NM_206697.1  CG1522-RB, transcript variant B (cac), mRNA 
0   18  NM_206693.1  CG1522-RF, transcript variant F (cac), mRNA 
0   18  NM_001014732.1  CG1522-RJ, transcript variant J (cac), mRNA 
0   18  NM_001014735.1  CG1522-RG, transcript variant G (cac), mRNA 
0   18  NM_206695.1  CG1522-RD, transcript variant D (cac), mRNA 
0   11  NM_132831.1  CG8184-RB (CG8184), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.