National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9520R-2 
 Symbol CG9520  Full Name CG9520 
 CG No CG9520  Old CG No CG9520 
 Synonyms unnamed, anon-WO0144478.18, CG9520 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGAACAGGACGTGGGTGGACACGAGCACGTGCACGAGAACTCGACCATTGCGGAGCGACT 60

                          ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     61  GTACAGCGAGGTGCGTGTGCTCTGCTGGATCATGACCAATCCGAGCAACCATCAGAAGAA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGCGCGCCACGTGAAGCGCACCTGGGGCAAGCGTTGCAACAAGCTGATCTTTATGAGCTC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CGCCAAGGACGACGAGCTGGACGCAGTGGCTCTGCCCGTAGGCGAGGGTCGCAACAACCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATGGGGCAAGACGAAGGAGGCCTACAAATACATCTACGAGCATCACATCAACGACGCCGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTGGTTCCTGAAGGCTGACGATGACACATACACGATAGTGGAGAACATGCGATACATGCT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTATCCGTACAGTCCGGAAACTCCAGTCTACTTCGGCTGCAAGTTCAAGCCGTACGTGAA 420

                          ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| silico     421 ACAAGGCTACATGTCCGGCGGTGCCGGCTACGTTCTCAGCCGGGAGGCTGTGCGTCGCTT 480

9520R-2.IR full       481 TGTGGTCGAAGCCCTGCCCA 500
                          |||||||||||||||||||| silico     481 TGTGGTCGAAGCCCTGCCCA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_135414.2  CG9520-RB, transcript variant B (CG9520), mRNA 
100  482  NM_164840.1  CG9520-RC, transcript variant C (CG9520), mRNA 
100  482  NM_164839.1  CG9520-RA, transcript variant A (CG9520), mRNA 
NM_165153.1  CG31817-RA (CG31817), mRNA 
NM_132878.1  CG9216-RA, transcript variant A (CG9216), mRNA 
NM_167485.1  CG9216-RC, transcript variant C (CG9216), mRNA 
NM_167486.1  CG9216-RB, transcript variant B (CG9216), mRNA 
NM_134946.3  CG8852-RA (CG8852), mRNA 
NM_138223.1  CG12502-RA (CG12502), mRNA 
NM_140258.2  CG7264-RA (CG7264), mRNA 
NM_135787.2  Rep4 CG9414-RA (Rep4), mRNA 
NM_176121.1  Hormone receptor-like in 46 CG33183-RC, transcript variant C (Hr46), mRNA 
NM_176122.1  Hormone receptor-like in 46 CG33183-RB, transcript variant B (Hr46), mRNA 
NM_176123.1  Hormone receptor-like in 46 CG33183-RA, transcript variant A (Hr46), mRNA 
NM_169099.1  CG2082-RC, transcript variant C (CG2082), mRNA 
NM_141327.3  CG2082-RB, transcript variant B (CG2082), mRNA 
NM_169100.1  CG2082-RA, transcript variant A (CG2082), mRNA 
NM_169102.1  CG2082-RD, transcript variant D (CG2082), mRNA 
NM_165895.3  CG30048-RA, transcript variant A (CG30048), mRNA 
NM_001014521.1  CG30048-RB, transcript variant B (CG30048), mRNA 
NM_079001.2  Posterior sex combs CG3886-RA (Psc), mRNA 
NM_132544.1  CG18130-RA (CG18130), mRNA 
NM_136122.2  Rab9 CG9994-RA (Rab9), mRNA 
NM_136065.3  CG17324-RA (CG17324), mRNA 
12  NM_142592.1  CG4462-RA (CG4462), mRNA 
NM_170436.1  CG7824-RB, transcript variant B (CG7824), mRNA 
NM_143481.1  CG7824-RA, transcript variant A (CG7824), mRNA 
NM_137303.1  CG5197-RA (CG5197), mRNA 
NM_167340.1  Phosphodiesterase 9 CG32648-RA (Pde9), mRNA 
NM_133154.2  kekkon5 CG12199-RA, transcript variant A (kek5), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.