National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9494R-1 
 Symbol Tsp29Fa  Full Name Tetraspanin 29Fa 
 CG No CG9494  Old CG No CG9494 
 Synonyms CG9494, Dm.Tsp29Fa, Tsp29Fa 
 Accession No (Link to NCBI) NM_078791.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Jeibmann A, Halama K, Witte HT, Kim SN, Eikmeier K, Koos B, Klämbt C, Paulus W.
Involvement of CD9 and PDGFR in migration is evolutionarily conserved from Drosophila glia to human glioma.
J. Neurooncol. (2015) 124(3) 373-83 [ PubMed ID = 26224160 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTCTTCCTGGCCGGAAAGTT 
 Primer Seq. 3'
aatctagaggtaccCCGCATGGGCGGAAATGTATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTTCTTCCT GGCCGGAAAG TTCTTCTCGA TCCCCACGTT CCTGATCGTG ATTGGATCGT 
0061 TCATCATCAT AATCTCTTTC TTTGGTTGCT GGGGTGCCCT GAAGGAGAAC TATTGCCTGG 
0121 TGCTCAGCTT CTCGGTCATG CTGGCCATCA TCTTCATCCT GGAGCTGGCT GCTGGCATCA 
0181 GTGGCTATGT GCTGCGCAAT GACGCCTCCG ATTTGATCAA AACTTCTCTG ACTTACTCGC 
0241 TGAACGAGTA TAACAGTATC AATCCAAATG CGACCACGAA ACTCTGGGAT GACATCCAGG 
0301 NATGAGTTCG AGTGCTGTGG TGTGACCTCA TACAACGACT GGATCACCGC CTTcNCTAAC 
0361 gGCGACCTGC CCATCTCCTG CTGCAACGTT CATGTCGGCG CAGTGGGCAC ATTCACCTGC 
0421 AATAATGCTC AGTCCAGCGT GGCAGACCGG CACAAAGTTG GATGCCTCGA CGGATTCTCC 
0481 GGATACATNT CNGNNCANGN GG 
 in silico PCR Fragment
0001 GC-TCTTCCT GGCCGGAAAG TTCTTCTCGA TCCCCACGTT CCTGATCGTG ATTGGATCGT 
0061 TCATCATCAT AATCTCTTTC TTTGGTTGCT GGGGTGCCCT GAAGGAGAAC TATTGCCTGG 
0121 TGCTCAGCTT CTCGGTCATG CTGGCCATCA TCTTCATCCT GGAGCTGGCT GCTGGCATCA 
0181 GTGGCTATGT GCTGCGCAAT GACGCCTCCG ATTTGATCAA AACTTCTCTG ACTTACTCGC 
0241 TGAACGAGTA TAACAGTATC AATCCAAATG CGACCACGAA ACTCTGGGAT GACATCCAGG 
0301 -ATGAGTTCG AGTGCTGTGG TGTGACCTCA TACAACGACT GGATCACCGC CTTCCCTAAC 
0361 GGCGACCTGC CCATCTCCTG CTGCAACGTT CATGTCGGCG CAGTGGGCAC ATTCACCTGC 
0421 AATAATGCTC AGTCCAGCGT GGCAGACCGG CACAAAGTTG GATGCCTCGA CGGATTCTCC 
0481 GGATACATTT CCGCCCATGC GG 
 Assemble Data

9494R-1.IR_full       1   GCTTCTTCCTGGCCGGAAAGTTCTTCTCGATCCCCACGTTCCTGATCGTGATTGGATCGT 60
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9494R-1.in silico     1   GC-TCTTCCTGGCCGGAAAGTTCTTCTCGATCCCCACGTTCCTGATCGTGATTGGATCGT 60


9494R-1.IR_full       61  TCATCATCATAATCTCTTTCTTTGGTTGCTGGGGTGCCCTGAAGGAGAACTATTGCCTGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9494R-1.in silico     61  TCATCATCATAATCTCTTTCTTTGGTTGCTGGGGTGCCCTGAAGGAGAACTATTGCCTGG 120


9494R-1.IR_full       121 TGCTCAGCTTCTCGGTCATGCTGGCCATCATCTTCATCCTGGAGCTGGCTGCTGGCATCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9494R-1.in silico     121 TGCTCAGCTTCTCGGTCATGCTGGCCATCATCTTCATCCTGGAGCTGGCTGCTGGCATCA 180


9494R-1.IR_full       181 GTGGCTATGTGCTGCGCAATGACGCCTCCGATTTGATCAAAACTTCTCTGACTTACTCGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9494R-1.in silico     181 GTGGCTATGTGCTGCGCAATGACGCCTCCGATTTGATCAAAACTTCTCTGACTTACTCGC 240


9494R-1.IR_full       241 TGAACGAGTATAACAGTATCAATCCAAATGCGACCACGAAACTCTGGGATGACATCCAGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9494R-1.in silico     241 TGAACGAGTATAACAGTATCAATCCAAATGCGACCACGAAACTCTGGGATGACATCCAGG 300


9494R-1.IR_full        301 ATGAGTTCGAGTGCTGTGGTGTGACCTCATACAACGACTGGATCACCGCCTTCNCTAAC 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
9494R-1.in silico      301 ATGAGTTCGAGTGCTGTGGTGTGACCTCATACAACGACTGGATCACCGCCTTCCCTAAC 359


9494R-1.IR_full       361 GGCGACCTGCCCATCTCCTGCTGCAACGTTCATGTCGGCGCAGTGGGCACATTCACCTGC 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9494R-1.in silico     361 GGCGACCTGCCCATCTCCTGCTGCAACGTTCATGTCGGCGCAGTGGGCACATTCACCTGC 419


9494R-1.IR_full       421 AATAATGCTCAGTCCAGCGTGGCAGACCGGCACAAAGTTGGATGCCTCGACGGATTCTCC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9494R-1.in silico     421 AATAATGCTCAGTCCAGCGTGGCAGACCGGCACAAAGTTGGATGCCTCGACGGATTCTCC 479


9494R-1.IR_full       481 GGATACATNTCNGNNCANGNGG 501
                          |||||||| || |  || | ||
9494R-1.in silico     481 GGATACATTTCCGCCCATGCGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078791.2  CG9494-RA (Tsp29Fa), mRNA 
0.2   NM_168375.2  CG32052-RA (CG32052), mRNA 
0   NM_143116.2  CG31300-RA (CG31300), mRNA 
0   NM_131920.2  CG6379-RA (CG6379), mRNA 
0   NM_137703.1  CG15655-RA (CG15655), mRNA 
0   NM_136755.2  CG16728-RA (CG16728), mRNA 
0   NM_133094.1  CG12609-RA, transcript variant A (CG12609), mRNA 
0   NM_167629.1  CG12609-RB, transcript variant B (CG12609), mRNA 
0   NM_132752.2  CG9517-RA, transcript variant A (CG9517), mRNA 
0   NM_167418.1  CG9517-RB, transcript variant B (CG9517), mRNA 
0   NM_165814.2  CG9062-RB (CG9062), mRNA 
0   NM_166315.1  CG12758-RB, transcript variant B (sano), mRNA 
0   NM_166314.1  CG12758-RA, transcript variant A (sano), mRNA 
0   NM_166316.1  CG12758-RC, transcript variant C (sano), mRNA 
0   NM_079064.2  CG12758-RD, transcript variant D (sano), mRNA 
0   NM_167834.1  CG17090-RB, transcript variant B (CG17090), mRNA 
0   NM_138194.2  CG17090-RA, transcript variant A (CG17090), mRNA 
0   NM_078720.2  CG11840-RA (Spp), mRNA 
0   NM_168906.1  CG5081-RB, transcript variant B (Syx7), mRNA 
0   NM_168905.1  CG5081-RA, transcript variant A (Syx7), mRNA 
0   NM_164459.1  CG31668-RA (CG31668), mRNA 
0   NM_079321.2  CG10571-RA (ara), mRNA 
0   NM_206027.1  CG9403-RD, transcript variant D (jing), mRNA 
0   NM_170346.1  CG31055-RA, transcript variant A (CG31055), mRNA 
0   NM_170347.1  CG31055-RC, transcript variant C (CG31055), mRNA 
0   NM_170348.1  CG31055-RB, transcript variant B (CG31055), mRNA 
0   NM_057493.3  CG3178-RA (Rrp1), mRNA 
0   NM_132740.1  CG15890-RA (CG15890), mRNA 
0   NM_167216.1  CG15312-RC, transcript variant C (CG15312), mRNA 
0   NM_132373.2  CG15312-RA, transcript variant A (CG15312), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.