National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9491R-2 
 Symbol Gef26  Full Name Gef26 
 CG No CG9491  Old CG No CG9491 
 Synonyms GEF, CG9491, dizzy, l(2)k13720, Gef26, PDF-GEF Dizzy, dPDZ-GEF 
 Accession No (Link to NCBI) NM_135168.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Le Bras S, Rondanino C, Kriegel-Taki G, Dussert A, Le Borgne R.
Genetic identification of intracellular trafficking regulators involved in Notch-dependent binary cell fate acquisition following asymmetric cell division.
J. Cell. Sci. (2012) 125(Pt 20) 4886-901 [ PubMed ID = 22825875 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGTGGGCAGCTCGACTACAATCAACCGGCCGGAACTGCACCAAAAATGCAACCGGGGCT 60

                          ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| silico     61  CGCACTCCAGTGACACCAGTTCGGCGTACAGCGGCAGCGATACAATGGCCTCGAACTATG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCTCGTCGCTGGAGGCCGAGGAGATTGACCTCTCCGGCCTGGTGGAGTCCGTTGTGGACT 180

                          ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     181 CTGACGAGGAGGACCTGGCGGAGAGCATGGATAGTCTTACCGTGCGGGATGCCGTGCGTG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACTGTCTGGAAAAGGATCCGGCGGAGCGCAGCGAGGAAGATGTGGAAGTACTGCTTGAGT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCACGCAGGGCCTTAAGGCATTCACAAACATTACGCTGGCAGTGCGAAGAGCACTATGTT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCGTGATGGTATTCGCCGTTGTGGACAAGGCGGGAACCGTGGTCATGTCAGATGGTGAGG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AACTGGACTCATGGTCGGTGCTCATAAACGGAGCGGTGGAGATCGAGCATGCAAATGGCA 480

9491R-2.IR_full       481 GTCGCGAAGAGCTGCAGATG 500
                          |||||||||||||||||||| silico     481 GTCGCGAAGAGCTGCAGATG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135168.3  CG9491-RA (Gef26), mRNA 
0   NM_139912.3  CG7574-RA (bip1), mRNA 
0   NM_078992.2  CG8581-RA, transcript variant A (fra), mRNA 
0   NM_165913.1  CG8581-RB, transcript variant B (fra), mRNA 
0   NM_079576.1  CG12809-RA (nerfin-2), mRNA 
0   NM_136727.2  CG18408-RA, transcript variant A (CAP), mRNA 
0   NM_132216.2  CG2116-RA (CG2116), mRNA 
0   NM_001015293.1  CG41114-PB.3 (CG41114), mRNA 
0   NM_137032.2  CG5970-RA (CG5970), mRNA 
0   NM_134981.2  CG3338-RA (CG3338), mRNA 
0   NM_169870.1  CG6184-RB, transcript variant B (CG6184), mRNA 
0   NM_142567.1  CG6184-RA, transcript variant A (CG6184), mRNA 
0   NM_132062.1  CG5921-RB, transcript variant B (CG5921), mRNA 
0   NM_167058.1  CG5921-RA, transcript variant A (CG5921), mRNA 
0   NM_165754.1  CG12214-RB, transcript variant B (CG12214), mRNA 
0   NM_136718.2  CG12214-RA, transcript variant A (CG12214), mRNA 
0   NM_164764.1  CG7052-RD, transcript variant D (TepII), mRNA 
0   NM_164763.1  CG7052-RE, transcript variant E (TepII), mRNA 
0   NM_164762.1  CG7052-RC, transcript variant C (TepII), mRNA 
0   NM_164761.1  CG7052-RB, transcript variant B (TepII), mRNA 
0   NM_078782.2  CG7052-RA, transcript variant A (TepII), mRNA 
0   NM_136255.1  CG8679-RA (CG8679), mRNA 
0   NM_130610.1  CG3600-RA (CG3600), mRNA 
0   NM_136643.2  CG8806-RA (prel), mRNA 
0   NM_137834.1  CG6018-RA (CG6018), mRNA 
0   NM_142448.2  CG8064-RA (CG8064), mRNA 
0   NM_132982.1  CG12996-RA (CG12996), mRNA 
0   NM_137807.2  CG5625-RA, transcript variant A (CG5625), mRNA 
0   NM_166518.1  CG5625-RB, transcript variant B (CG5625), mRNA 
0   NM_130669.2  CG2701-RA (CG2701), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.